Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YGL072C
Strain S288c
Description Dubious open reading frame unlikely to encode a protein; partially overlaps the verified gene HSF1; null mutant displays increased resistance to antifungal agents gliotoxin, cycloheximide and H2O2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGL072C	6321366 upstream sequence, from -1000 to -1, size 1000
CCAAGGCTTAATATCGGACTTATCTTCAAAGTTGGGTACTGGATCCAGATGAATCAAATT
GTTTTGATTCAGCTTTTCCACATGATGAATATGCCCAATAGTTTCCGTCGGCGATGTTGA
GGTATGAACATGCTGATCAATATTGAGGGAATGTGTGCTTTTGAGATTCAGTGTCATTAT
GGGAGACGGCACTGCGGCTGGATTTCCACTTGCACTTGCACGACCCTCATTATGGTTGAC
TACATATTCACTAGCACTTTTGGGTAGAGCATATACAAAGGAGGATGAATGGCTGTCAGA
TGAATTAATCGGTGACGCATGTTCTATGTCAGCCGGATTGAAGCCTTCCATTGTCGTAGA
TTTTTCTGTTATTTTTTTGTTTTTAAAAATAGTATAACTGTTAGACTTGTATCAAAAACC
TACGGTATAGCATGAATCGTCGTCTATCACTCCCAATTATATTATGATAATTTGTCTTCT
TTTGTTGTTCCTATGGATTTACTCTTTTGCTAGGGAGTTTCTGTCGCTAAGAGGTTTGTC
AATGACACCGAAAAGAGGATAATAGGTAATACTTTTTGTAACTGTAAAGAATATTAAATC
GTTTTCACGGAATTGGCCTCTTCCCTATATTCTATCCGAGGTTGTGTACTGTAGCGGTTT
ATACTTCAACCTGTGAAAGTTATGTAATATGCGAATTCTGTTTCTGCTTGATAATCTGAA
GAATATAGTCTCGAGCACGCGATGGAGCAGAAAGGGGAGAAATGAATACTGATGAGCTTA
ACGATGAGGAGGCCGTTTCCGTTTCTCTTGATTACCCTTTCATCCAACAGTCAATATAAG
TACGCCAACTTGCGTTAAAACGGCCAATGTGACACCAGTTCACTCGGCAAGCCCTTCTCA
GGCTCTCACTAGCTCGAATAACGAGAACTCTTCACGACTCATCTACTTGGCATTTTCCGG
GTGCAGTTCAACCTCACTCGCGTGCGGCGGTGTGAGGTGC
Chr coordinates
w3c xhtml validator w3c css validator