Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YGL072C
Strain S288c
Description Dubious open reading frame unlikely to encode a protein; partially overlaps the verified gene HSF1; null mutant displays increased resistance to antifungal agents gliotoxin, cycloheximide and H2O2
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YGL072c_YGL072c	YGL072c unspliced ORF sequence, from start to stop, size 360
ATGGGTGCCGGTATTTTTTTTAGTTCGCTCTGCGCCTTACGCGATCAGCTTCGAGAACAT
ACTATATTAAATGATTATATACGCTATTTAATGACCTTGCCCTGTGTACTATTTCTTAGC
TCGTTTGGGCAGGCGGTGATCGTTGTACTCTGTCGGGTCCTGTATTTCGACTATAGCCGG
TTCCGGTATTTCCTCCACAAATCTTTTCTTAGCGTTCTCGGGCGCCGTGTCGGCCTGGGT
GGAATAACTGTGGTCATTAAAGCTTGGCAGGTTATCACTCACTTTAGTGTTTTCAGTGGC
GCTGAACTTTATATCGGGGGACACCCTTGTACTTCCCTCACTAGTGTTATTGTCGTTTAG
Promoter Sequence
Download FASTA
>YGL072C	6321366 upstream sequence, from -1000 to -1, size 1000
CCAAGGCTTAATATCGGACTTATCTTCAAAGTTGGGTACTGGATCCAGATGAATCAAATT
GTTTTGATTCAGCTTTTCCACATGATGAATATGCCCAATAGTTTCCGTCGGCGATGTTGA
GGTATGAACATGCTGATCAATATTGAGGGAATGTGTGCTTTTGAGATTCAGTGTCATTAT
GGGAGACGGCACTGCGGCTGGATTTCCACTTGCACTTGCACGACCCTCATTATGGTTGAC
TACATATTCACTAGCACTTTTGGGTAGAGCATATACAAAGGAGGATGAATGGCTGTCAGA
TGAATTAATCGGTGACGCATGTTCTATGTCAGCCGGATTGAAGCCTTCCATTGTCGTAGA
TTTTTCTGTTATTTTTTTGTTTTTAAAAATAGTATAACTGTTAGACTTGTATCAAAAACC
TACGGTATAGCATGAATCGTCGTCTATCACTCCCAATTATATTATGATAATTTGTCTTCT
TTTGTTGTTCCTATGGATTTACTCTTTTGCTAGGGAGTTTCTGTCGCTAAGAGGTTTGTC
AATGACACCGAAAAGAGGATAATAGGTAATACTTTTTGTAACTGTAAAGAATATTAAATC
GTTTTCACGGAATTGGCCTCTTCCCTATATTCTATCCGAGGTTGTGTACTGTAGCGGTTT
ATACTTCAACCTGTGAAAGTTATGTAATATGCGAATTCTGTTTCTGCTTGATAATCTGAA
GAATATAGTCTCGAGCACGCGATGGAGCAGAAAGGGGAGAAATGAATACTGATGAGCTTA
ACGATGAGGAGGCCGTTTCCGTTTCTCTTGATTACCCTTTCATCCAACAGTCAATATAAG
TACGCCAACTTGCGTTAAAACGGCCAATGTGACACCAGTTCACTCGGCAAGCCCTTCTCA
GGCTCTCACTAGCTCGAATAACGAGAACTCTTCACGACTCATCTACTTGGCATTTTCCGG
GTGCAGTTCAACCTCACTCGCGTGCGGCGGTGTGAGGTGC
Chr coordinates
w3c xhtml validator w3c css validator