Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL7A
Systematic Name YGL076C
Alias L30, L6A, L7A, rp11, uL30, YL8
Strain S288c
Description Ribosomal 60S subunit protein L7A; required for processing of 27SA3 pre-rRNA to 27SB pre-rRNA during assembly of large ribosomal subunit; depletion leads to a turnover of pre-rRNA; contains a conserved C-terminal Nucleic acid Binding Domain (NDB2); binds to Domain II of 25S and 5.8S rRNAs; homologous to mammalian ribosomal protein L7 and bacterial L30; RPL7A has a paralog, RPL7B, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL7A YGL076C
ACAGATTTAGAAACTGAATACCGTTCAAATGCCAATGTGGATGACGCATATAGTAGAGTA
TTCGGCATTTAAACCTTGGCCTTTGCACCGTGCCACTTCATACACAGTGAAAATAGTCAC
GTAAACCGTTCATGATATCCTTCAATTCAAAATAATTCAGCATTGATGTGCGTCTACGAC
AATCGCTAGTCCTAACTTTATTTTTTTTTTTTTTTTTTACATCTGCCGTCACCCTTGCGA
TGAACGAGAAAAAAACCGCCTTTCGAAGTATAAAAAGGATGAACTCGATATTTCAGCAAC
ACATTCTTTACCTTGGTCTTTTCTCATTTTGTTACAAAAATATATACTTATAATAGCACA
GGTTTTATTATTTTAGATATGCATAACACAAAATAATGTGCGTGGCAGCGTTGATAATAA
CGAGCTAATGTCTTATATCTCATATGAGTTCATGTGATATTTCATGTTACAGCTCAGATG
CGTAAACTCTCTATCCAAGATGAGGAATAGGATAAAGAGATGTATTTATTTAGTGATGAT
ACTGCCGATTCTGGCATTCCAAAAAGTGACTAGCAAAATTGCGATGTTGTCAACTTAAAT
TACACCATCTTTCGGGGCTGATATTTAATACATCTATTTTATCCATTCTTCTACGTATTA
CGTTTGTAGCTTGGCCAAAAAAATATCTTGCATAATTTGTACTCCAGTTCACATCAGTTG
AGTAGAGAATAGCTACTGATCATATAAACACCCACACATATCTATAAATCCGTACCTTTC
CTATATATATATATATATTTTTTCAAATTTTGTCTGAAATTCTTTCTGCAGGTTTGTCGC
TGCCGGACGCGACTTCTGAGAATCATTGCCATCTGTATCTGTATCACTTTGACAACTTCA
TCCTTTCTGAAATATTGAAATAATCAAGACACTAGATCTGCCTTGTATTGTCTTCGGTTC
ATATAAATCCAAATAACCAACCAAGCAAATTAAGATCACA
Chr coordinates Chr VII from 364964-364335,365526-365433,365996-365986
w3c xhtml validator w3c css validator