Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DBP3
Systematic Name YGL078C
Strain S288c
Description Putative ATP-dependent RNA helicase of the DEAD-box family involved in ribosomal biogenesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DBP3 YGL078C
TATTTACCTCTTTTGGTTGCGTCATTGCTTGTCACACTTGGCAGGCAAGGTTATGTTGGT
CATTTGCCAGGGACAATGGTCTTCCATTATCCCGTTTATGGTCGCAAGTTAACCCACACA
CTGGTGTACCTTTGAACGCTCATTTAATGTCATGCGCTTGGATAACCCTCATTGGCCTAC
TTTATTTGGCTTCCAGTACGGCTTTTCAGTCCTTAATTACAGGTTGTATTGCATTTTTAT
TGTTATCCTACATCATTCCGGTTATATGTTTACTTGCTAAAAAGCGTAACATAGCTCATG
GTCCATTCTGGCTTGGAAAATTTGGATTTTTTTCAAACATTGTTCTTTTGGGTTGGACTG
TCTTTTCTGTGGTCTTTTTTTCCTTTCCACCAGTTTTACCTGTGACAAAGGATAACATGA
ACTATGTTTGTGTAGTTATTGTTGGTTATACTGCGTATTCGATTCTTTACTGGAAATACA
AGGGTAAGAAGGAATTCCACGCTTTAGAAGAATCTGAGAACGAACAGGCTGAATATAGTA
ATAACTTCGATACCATTGAAGATAGTCGAGAATTTTCCGTTGCGGCCTCTGACGTTGAAC
TCGAAAATGAACACGTACCGTGGGGAAAGAAGTGAATTTATAGTGTTGATCAGTCGACCG
TTATTTATTTTAAGTATATTATTTGCATAGAAGTAATAAAAGTGAATTTTTTTTAATGGT
TTGTTAAGCCATTTTAGACGAGGGACTAAGATATTTCAACCTAAATATCCCTCAGGCTTT
GCGCTCTTGAAAGCGATGTGACTGTAATTCAAATTTCTTGAAATATTTTTGCGGGAAAAA
GATGAAAAATTTTTCACCTCATCGCATAAGAAGCAAATAAAAAAAAAATATTAATAATAG
ATAGGCAACAATATAGCAGCTCAGAGATATAGCTTAACTTCATTTTACAGCCTTTTAACG
AAAGCATAAGTATTAACAGTTTGATATATAGGGGATTAAA
Chr coordinates Chr VII from 361859-360288
w3c xhtml validator w3c css validator