Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DBP3
Systematic Name YGL078C
Strain S288c
Description RNA-Dependent ATPase, member of DExD/H-box family; involved in cleavage of site A3 within the ITS1 spacer during rRNA processing; not essential for growth, but deletion causes severe slow-growth phenotype
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>DBP3 YGL078C
ATGACAAAGGAAGAAATCGCAGACAAGAAGAGAAAGGTTGTAGATGAGGAGGTAATTGAA
AAAAAGAAGAGTAAGAAACACAAAAAGGATAAGAAAGACAAGAAGGAAAAGAAGGATAAA
AAGCATAAAAAGCATAAGAAGGAGAAGAAGGGTGAGAAGGAAGTGGAAGTACCAGAGAAA
GAATCTGAAAAGAAACCTGAACCTACTTCTGCAGTGGCTAGTGAGTTTTATGTTCAGAGT
GAAGCACTAACCAGTCTTCCACAATCTGATATTGACGAATATTTCAAGGAAAATGAAATT
GCTGTTGAGGATTCTCTGGATCTAGCCCTACGTCCGCTATTATCATTTGATTATCTTTCT
TTAGACTCTTCCATTCAAGCAGAAATTTCCAAATTTCCAAAACCAACGCCTATTCAAGCC
GTAGCCTGGCCATATTTGTTATCTGGTAAAGATGTTGTTGGTGTTGCTGAGACCGGTTCT
GGTAAAACATTTGCTTTCGGTGTTCCAGCTATCAGCCATTTAATGAACGATCAAAAGAAA
AGGGGCATACAGGTTCTAGTCATTTCCCCAACTAGAGAACTTGCTTCCCAAATTTATGAT
AATCTGATTGTATTAACTGACAAGGTTGGTATGCAGTGTTGTTGTGTTTATGGTGGTGTT
CCAAAGGATGAGCAAAGAATTCAGTTAAAAAAGTCACAAGTGGTGGTTGCTACACCTGGT
AGATTATTAGACCTATTGCAGGAAGGATCTGTTGACTTATCTCAAGTTAATTACTTAGTA
TTAGACGAGGCAGACAGAATGTTGGAAAAAGGTTTTGAAGAAGACATCAAGAATATTATC
AGAGAAACTGATGCGTCCAAAAGACAAACTCTAATGTTTACCGCTACCTGGCCAAAGGAA
GTCCGTGAATTAGCTTCCACGTTCATGAACAACCCAATCAAAGTATCTATTGGTAACACG
GACCAACTAACTGCTAACAAAAGAATTACACAGATTGTTGAAGTGGTGGACCCACGTGGA
AAAGAAAGAAAGTTATTGGAACTGTTGAAAAAGTACCACTCTGGTCCAAAAAAGAATGAA
AAGGTCTTGATTTTTGCTCTTTATAAGAAGGAAGCTGCTCGTGTTGAAAGGAATTTGAAA
TATAACGGGTATAACGTCGCAGCTATCCATGGTGATTTGTCCCAGCAACAAAGAACGCAA
GCATTGAATGAGTTCAAAAGCGGGAAGTCTAACTTGTTACTGGCCACCGACGTTGCAGCA
AGAGGTTTAGATATACCAAATGTTAAGACAGTTATTAATTTAACTTTCCCATTGACTGTG
GAGGATTATGTCCATAGAATCGGTAGAACTGGTAGAGCTGGTCAAACAGGCACAGCACAC
ACTCTGTTCACTGAACAAGAAAAGCATTTGGCTGGTGGACTGGTTAACGTTTTGAATGGT
GCCAATCAACCTGTTCCTGAAGATTTGATAAAGTTCGGTACTCACACTAAGAAGAAGGAA
CATAGCGCTTATGGTTCATTCTTTAAGGACGTCGATTTGACTAAGAAACCAAAAAAAATT
ACTTTCGATTAG
Promoter Sequence
Download FASTA
>DBP3 YGL078C
TATTTACCTCTTTTGGTTGCGTCATTGCTTGTCACACTTGGCAGGCAAGGTTATGTTGGT
CATTTGCCAGGGACAATGGTCTTCCATTATCCCGTTTATGGTCGCAAGTTAACCCACACA
CTGGTGTACCTTTGAACGCTCATTTAATGTCATGCGCTTGGATAACCCTCATTGGCCTAC
TTTATTTGGCTTCCAGTACGGCTTTTCAGTCCTTAATTACAGGTTGTATTGCATTTTTAT
TGTTATCCTACATCATTCCGGTTATATGTTTACTTGCTAAAAAGCGTAACATAGCTCATG
GTCCATTCTGGCTTGGAAAATTTGGATTTTTTTCAAACATTGTTCTTTTGGGTTGGACTG
TCTTTTCTGTGGTCTTTTTTTCCTTTCCACCAGTTTTACCTGTGACAAAGGATAACATGA
ACTATGTTTGTGTAGTTATTGTTGGTTATACTGCGTATTCGATTCTTTACTGGAAATACA
AGGGTAAGAAGGAATTCCACGCTTTAGAAGAATCTGAGAACGAACAGGCTGAATATAGTA
ATAACTTCGATACCATTGAAGATAGTCGAGAATTTTCCGTTGCGGCCTCTGACGTTGAAC
TCGAAAATGAACACGTACCGTGGGGAAAGAAGTGAATTTATAGTGTTGATCAGTCGACCG
TTATTTATTTTAAGTATATTATTTGCATAGAAGTAATAAAAGTGAATTTTTTTTAATGGT
TTGTTAAGCCATTTTAGACGAGGGACTAAGATATTTCAACCTAAATATCCCTCAGGCTTT
GCGCTCTTGAAAGCGATGTGACTGTAATTCAAATTTCTTGAAATATTTTTGCGGGAAAAA
GATGAAAAATTTTTCACCTCATCGCATAAGAAGCAAATAAAAAAAAAATATTAATAATAG
ATAGGCAACAATATAGCAGCTCAGAGATATAGCTTAACTTCATTTTACAGCCTTTTAACG
AAAGCATAAGTATTAACAGTTTGATATATAGGGGATTAAA
Chr coordinates Chr VII from 361859-360288
w3c xhtml validator w3c css validator