Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PAN2
Systematic Name YGL094C
Strain S288c
Description Essential subunit of the Pan2p-Pan3p poly(A)-ribonuclease complex, which acts to control poly(A) tail length and regulate the stoichiometry and activity of postreplication repair complexes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PAN2 YGL094C
TTGACTCAATGCTTTCTCCCTCTACATCTGGATTTTTCTGTCTGATACTCCGAGGAAAAA
CTTCAGTCATTTCCATTGATGTGGGATCATGCTGTGAAGCCTTGTTACTATCCGGTGTCG
CCACTATAGGTTCTGTCAATTCCATCCCAGATGTATCGGGATCTTCTTCTGCCGCTGTTT
TTTCTTCCGTACGAGCATCATCGATTTGAGTAGACGTTACAAGAGGCTCTTCTTGACTAG
ATATTTTAGTAGGGCTGTTGGTTGAAGTTTTTCTACGTCTTGGTTCCTTAATTTCATTGT
TTTGTTCAGGTACGAAAGTAAAACTATGCAACGTAACATCGGGAGCGAATGAAACTCTTC
TCTTTACCATACTCTGTAAATTAGAAGTATTGATCCTGGATGTCGTGTTACTACCATCTA
ATACTTCTTTTTTTGTTATAATCCTGGTAGGAATACGAACACCAGGGTTCTCTAGAAAGC
TTGAAGTCATTTGCGAGCTTTGGTTCTGCTTAAGAATGCCTTTCCCGGGCCCCGCATCCT
TCTCTCTACCCCCAATCCGGCTTCTTTCATCCACATTCATTGTCAGCCCACTTAGATATC
ACAAGGGACGTCGTAATCACGGTTACTAAGTACTTAATCACTGAGTGTAGTGTCTAATTA
GCCTTTGTTTTGTTATGTGTTTATCTATTTGTATTAAAACGGGGCGGGTGGCGCCTTCTC
TTTCGCGTATTGTTTTTTTCAATGAGAGAATAACGAAAAAGAAACATGCTTTTAACGTTA
GCATATATAGGAAATAACGTACTATGTGGGCATAGAGGAACACAAGAAATAGAATCTCCA
AGAGACACATCATTACCATATAATACACGTTCATTTTAACTAGAATTTTTACATTCTGAA
AATTTTTTTATTTGCTTATTTTTTGTTTTGAACTGCATTACACCCTAAGAGATTACTAGA
ACACAATTGCTATACTGAGTTTCTGAATGGTGAATGTATT
Chr coordinates Chr VII from 334465-331118
w3c xhtml validator w3c css validator