Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEH1
Systematic Name YGL100W
Strain S288c
Description Subunit of the Nup84 nuclear pore and SEACAT subcomplexes; involved in nucleocytoplasmic transport and NPC biogenesis in the nuclear pore subcomplex; subunit of SEACAT, a subcomplex of the SEA complex that inhibits the TORC1 inhibitory role of SEACIT (Iml1p-Npr2p-Npr3p), a GAP for Gtr1p in response to amino acid limitation, thereby resulting in activation of TORC1 signaling; SEA is a coatomer-related complex that associates dynamically with the vacuole; human SEH1 homolog
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEH1 YGL100W
TAGGGAGATTTTGGCAATTCTTTCGAAACCTCACCCAAATTATCAGTTAGCGTTTTTGAA
TATTATACAACTTTTGAAAACGCAAAGAAGAACTGGTTGGGTTGACCATGGTATTGACCC
ATGCGAAAGTATATCTGACCATATGTACAGAATGGGTTTAACTACCATGCTGATTACGGA
CAAGAATGTTGATCGTAACAAATGTATCAGAATCGCACTTGTTCACGATTTTGCGGAGTC
ATTAGTTGGTGATATTACACCTAATGACCCAATGACAAAGGAAGAGAAACATCGCAGAGA
ATTTGAAACTGTCAAGTATCTCTGTGAAAGCATAATAAGGCCCTGCAGTGAAAGCGCATC
TAGGGAAATTCTTGATGACTGGTTAGCATACGAAAAGCAGACCTGTTTGGAAGGAAGATA
TGTCAAAGATATTGATAAGTATGAAATGTTGGTTCAATGTTTTGAGTACGAACAAAAGTA
TAATGGCAAGAAGGATTTGAAACAATTTTTGGGAGCCATCAATGATATAAAAACTGATGA
AGTTAAAAAATGGACACAATCTTTACTGGAAGATCGACAAGCCTTTTTCGACAGTTTGAA
GGAGTAATAATGTGGCCTTTTGAAAGAAAAGTTAGTGCTTTTTTTTCTTTTCTCAAACCT
TCACCTGGTGGTGCGTATCATTTATAATAACATCTTGATGCTTTTCAACGAGATAGTGCC
CATTTTATTTTGCATGTATTATACTTCCAGCACCCGGTGTGCATTATATGTAACTTTAGA
AATAATCTTTTGTATATTATTCGCGATTGAATGTGCGTGCTGCATTATCAACCAAGTTTT
AATATATCTGTTTCTCTTATTTATTGTTAGTTAAGTCTTCGGCAAAACGATGGAAAAAAT
CATGAACTGAATAGAGACAAGTAAACCAAATTATAAACAAGGTTTCCCTTCTGAAGAGAT
ACTAAGGAAGAAGAAGAACGACCCAATAATATTTCTGAAT
Chr coordinates Chr VII from 313234-314283
w3c xhtml validator w3c css validator