Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARC1
Systematic Name YGL105W
Strain S288c
Description Protein that binds tRNA and methionyl- and glutamyl-tRNA synthetases (Mes1p and Gus1p), delivering tRNA to them, stimulating catalysis, and ensuring their localization to the cytoplasm; also binds quadruplex nucleic acids
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARC1 YGL105W
AGTAGTAACAAAAGCATTTTGAAGTAAGATTTGAAACAAAATAATACTCAGAGTAGATCG
ACGTATAAGAGTTCCTTCCCCAGCGTATTCCGCCACCACCCATCGCACATACATAGAATA
ACAATGTCAGCCACCAGAGCCAATAAAGATATTTTCACACTATTCGACAAGAAGGGTCAA
GGCGCCATTGCCAAGGATTCCTTGGGAGATTACCTGAGGGCAATTGGCTACAACCCCACC
AACCAGCTCGTACAGGACATCATAAACGCGGATTCGAGCTTGAGAGACGCCTCTAGCTTG
ACGCTGGACCAGATTACAGGCCTAATTGAAGTCAACGAAAAGGAATTGGATGCAACTACC
AAGGCAAAGACAGAAGACTTCGTCAAGGCATTCCAGGTCTTCGACAAGGAAAGTACAGGC
AAGGTATCCGTTGGTGACTTAAGGTACATGCTAACTGGCTTGGGTGAAAAGTTAACCGAC
GCTGAAGTAGACGAGCTGTTGAAGGGTGTTGAAGTGGACAGCAACGGAGAAATTGACTAC
AAGAAGTTCATCGAAGATGTTTTGAGACAATGAGAGTGCGGAACTGCAAATTTAGACATT
TATTACTATATAACAGAGTCCTATCGACATAAAAACGAAAAAAGCGCCATTATGCAATGA
AAACTTGCCAGCGGTTTTTCATTTTTCATACTGGTAATTCAGAGAGCCAAGTCTTTCTTT
ATAATGCATAGCAATAAATAGTCATATATATATATATATATATATATATATGTACATATA
TATGAACATATATATGAACAAATAAATGATAATGGTATGTGATAGTCATTATTAACGATT
AAGCGTTTTTCTTCAGTTTCTGAGGGATTCTAACCGCTTGGCGATTTTGCAAGAGATAAG
AAAATTTTTCAGTCATATGGATAACCTAACACAGCGTGCGACGTATTTTACTTCAGGGCC
CAATTGAATAAGAAAGTATAATATAGAGTTTCAAGAGTCA
Chr coordinates Chr VII from 307437-308567
w3c xhtml validator w3c css validator