Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MLC1
Systematic Name YGL106W
Strain S288c
Description Essential light chain for Myo1p, light chain for Myo2p; stabilizes Myo2p by binding to the neck region; interacts with Myo1p, Iqg1p, and Myo2p to coordinate formation and contraction of the actomyosin ring with targeted membrane deposition
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MLC1 YGL106W
CTTTGACGCTTCCCAAATTCGAATACAGTCATCGTCAAATGACAGCTCTTTAAATGAAGT
CAATAGATGAGTAGCTCCATATCCGCTGACAGACACCTTGCCTATCAAAATGTCATCAGA
TATATCCTTTAATGAATTACATAGAAAGTTCATCATTTCCTTGTGAAAAGATTGCGAATC
GTAGTCTGGCTTTCTACTTAATTTTACCAATTGGTCTCTCGTCGACCTCAGACCGTTATG
CAGCAGATGAATCAAACGTGACACCCGGTACGCATTGAAATCAGGCGATTCTCTCAAAGA
ATAGTATAACTCCATTGCTCTGCCCATGGAGTCCCAAAACATGGCGAATGATGGATTTTT
ATTCAATTGGTTGTTTCCTATTCTTTTGTATGTATTTTGCAAAGGCGTGGTAGAGTACTT
TAAAGCAGATGATACACACTCATCAAACGAAAGAAGCTCGTGGCGCCATGGAGAAGCTGG
ATCCACATTAAACACATTCTGTTCTGTTTTGCGCTGTTCTCGCCCATTCTTCTTGTCCAA
AACGCCCTTAGGTACATTTTTATGAAATATCGGACTGGAGTGGTAAGTACGGTCGCTAAG
AACTACGTTGGCAAGCTTACCTCTCAGCATTGCTATCGAACCGGAGTTAACAACGTTGCT
TACGCTTATTTCCATAGTTTTTAACGATCTCACCGCATTTCTTCTAAGCATCATTGTCCC
TTTTGCAGTATATGGACTCTCCGAATAGTGTAAGAAAATGACACTGAAACCTCACCTTCT
TTTACTTATTGCTTAGACCCTCATTACAATGCCATACTGAATACATTTTTTCGAATCTTG
TTCAGTCAGGAACCTCAACCATATATCATTACACACGAGTAGTAACAAAAGCATTTTGAA
GTAAGATTTGAAACAAAATAATACTCAGAGTAGATCGACGTATAAGAGTTCCTTCCCCAG
CGTATTCCGCCACCACCCATCGCACATACATAGAATAACA
Chr coordinates Chr VII from 306560-307009
w3c xhtml validator w3c css validator