Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TAF6
Systematic Name YGL112C
Alias TAF60, TafII60
Strain S288c
Description Subunit (60 kDa) of TFIID and SAGA complexes, involved in transcription initiation of RNA polymerase II and in chromatin modification, similar to histone H4
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TAF6 YGL112C
GGGCCATGGGCCATACTGGGACTCTCATATCCAACCTGTCGTTTTTAACATTCTTGGCTT
CCCAAATTTGCTTTAAAGATTGGAAACTCGAATCTATTTCCACTAATTTTATTAAATTCT
CCTCCCCTCCGTATGCAAATATATATTTATCAGTATCGGTATCTTCTAGATCATATAACT
GAAGAAATTCTACTGGTGCTTTCAGTCCAAGGGATGCTAGTTTTATTAACTTTTTATCTT
CTCCTTTTTTTATAATATGTAATAATCCCGATTTGGTAGCAGCTACGAATGTGTTATTCG
ACGAATCCTTTTTTATGGGACATAATGTGACAAAACCATCCACCAACTTGGTTCTTTTAA
CAGATTTACTTGAAAGTGATTCCAATTTGGCATCATCAAAAAGGTCTGAAACTGAGCTGG
TTATCTCAAACTCGGATATGTCAAATTTGGGTAGATCATCGGAAAGGCTCTTTTCATTTT
TGCTTTCTCCTTTGGGATCGACCTGGAGAGCTTCATTTTCTTTAAGGTGTTTCGAAATCT
TTACAAGTTCGACGACCCCTGAATTCCTTGCTAAGATGGCTTCATCTTCGGATATCACCC
ACATCCTGTCAACGTAAGCTTTCAATCCTTCGGCTAGATGAGGTGCCACATGAAAAGGCT
GCAGTGCTGATTGTACGGAAGTGTCAGTCCCGATGTTACACAAAACTTCCTTTATGGATC
CACTATCCACACAGCTGACTAGTAACCTCATTTTACGATCGAAGCTGGGCCTATTTATGG
TTAAATTTTCTCTGTATTATGTTCATTGAAGTGAGGCTTCGAGATTGGGCATCGCTTTAC
AAAATTTTTCAGCTTTATTTTATTACCAAAAAAATACCCGGAAACCATCAATAACAAACA
CCGATTCAAGTAGCAGCAAAAGTAGTTCATGAGCGAAAACAATAGATTGGCTTTAAAAAG
GAAGCAAAGGACGCCTCAGTGTAGTTGATAGCCTGTTAAA
Chr coordinates Chr VII from 299728-298178
w3c xhtml validator w3c css validator