Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGL117W
Systematic Name YGL117W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YGL117W YGL117W
ATGCAGCCAATTTCAATAAAAGATGTGGAAAGCGATCAAGGGAAAGTTTACATTGTTAAT
GCCTTAAAAGATCTCGTATGCAAGTGCCTTTTAGAATTCGTGGACATTCAAATTGAAAGT
TTTATGTATCCGGACGATCCAAAGTGTTTTACAAGGATATTTAAAGGGAACAAGATAGTC
AACGAAGCATCAGATAAAGATTCGAAAGTGAGAAGTTACCCATCTTCATTGGGTGTTGGA
CACTCTGCTTTGTTTCCTTTGATATACATAAGACAAAAAACCAACTCCTTGCGGTTTTTG
AATGATCCAAAGCAATTACCAACACCACTGGTCGATGATATGAACGCAAAATTCAAAGGC
ATCATTAAAGTTTATGAAAATCTCATTCACTTGTACCATTCATATCAGACGGTGGATTGC
AATAACATGAATCAGCAAAAGCTTTTGGGTGATCTGGTCAGTCGGGGTAATTTCATGCTT
GATATCCTCCACGGGTATGTTACTATTGCATCAACAATAGTACGGGACAGTAAGGATGCC
AATATCTTGATAGACACTGTTAATCGGTTCATCCACGATACCATATTATTCCACAAGCGC
ATAATACATAATTCCAACGCTTACACAGAGTACCATGTAATGAAACGTGGCATGCAAAGA
AACCAGAGTGAGGAAACGTTAGTTGAACTTGAATTCCGAATACTGGATGTTTCTGATGTT
AATCTGGACAATGAATTTGATGACTTTTTACAGCATAGAAAAACGTCTCTTAAAATAACT
CATAGAAGGGTTATATGA
Promoter Sequence
Download FASTA
>YGL117W YGL117W
AAAACGGCTCCTAGTTATCGTCAGTTTTGATAATTAGTAACTAGAATATAGTATCACCAA
GAACAGGCCAGGTAATATACTAGAAGTTGTGTATAACTACTAATATTTTTATACATATAG
ATGCCAAGTCAAGGTCCAATTAGTAGATTTTTCACTCTACCTTGCATTATTACCTGAAAG
ATCGTTTGTGTTTCCTTAAATTCGCCAGAGGTGCAAACGAATGTAAATATCTACATCAAT
TTACGGTTTCACGCCCGTTTCGTTTCTAATGGCAACTCATGTAAACTGTGATAAACCCGT
TATTTCAGTTTTATTTTCTGCTAGTATAAAGGATGATAGTAGCCATTTCGCTGGAATATG
TATCGGGTTTAAAAGATGGCATAGTTCGAAACATTTTCGCACAAGATTCTAACTGTCTTC
GAACGTCGTAGAAACCGCAACGCAAGAAATGACAGCGCAATAAAATTTATTTTACTAACT
GATAGAACAAATGTAAAAAATTTCATAATATCAAGTAGAATTCTTTATTCTCTTTGTGAA
TTCCTAAACCCATGAAAGGGACTTGTAGTATAAGCTGGATACCTATTTTCATTGGCTTCG
TTTCCAAATGACACAAAACCATCACAAAAGGAAATAGTCCTTCCATAGTTACCCAATCAT
TCTGTTGCATATTAAATGAACAGCTCCTTGTTGATAATGCCAGTGTGGCATATTCACCGC
TGCAGTTATTTCTTTTCATATATAATGAGTCATTTGTTTCTGTCATCACTTTTCTATACT
TTCTCTTCCCCGCGTGTTTTCCGTACACCAACAATATATGCCATAATACACGTAACATTT
TTTTATAAAAAGAAAAGGTAAGTGATATATATAAAATAGCGCCATGAGTAGGAAACTTTT
CTGTTACTGCAGATATGTGCCAGACTGGCTCAGGTGGCATAAACACAGATTAATAGTATT
GGCGTTGCTGAAATAAGAAGATCTGTAACAATATCTTACA
Chr coordinates Chr VII from 288512-289309
w3c xhtml validator w3c css validator