Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPG1
Systematic Name YGL121C
Strain S288c
Description Proposed gamma subunit of the heterotrimeric G protein; interacts with the receptor Gpr1p; involved in regulation of pseudohyphal growth; requires Gpb1p or Gpb2p to interact with Gpa2p; overproduction causes prion curing
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPG1 YGL121C
CTTATGAATATGGTATCCATAAGTGGTGCCGTGACCACTATCTAAATTACAGGTCCCTTT
CCGCTGCTGATAATATCCGCTCCCAATTAGAAAGATTAATGAACCGTTACAACCTAGAAT
TAAACACTACAGACTATGAAAGCCCTAAATACTTTGACAACATCAGAAAGGCTCTTGCGT
CTGGGTTTTTCATGCAAGTAGCAAAAAAAAGATCGGGAGCTAAAGGATACATCACAGTTA
AAGATAACCAAGATGTTCTGATCCATCCTAGTACGGTTCTTGGCCACGACGCAGAATGGG
TCATTTACAATGAATTTGTGCTCACATCGAAGAACTACATAAGAACTGTGACCTCGGTCA
GGCCCGAATGGCTGATTGAAATAGCGCCTGCATACTACGACTTAAGCAATTTCCAAAAAG
GTGATGTCAAATTATCTTTGGAAAGGATCAAGGAAAAAGTTGATAGATTAAACGAGTTGA
AACAAGGTAAAAACAAAAAGAAGAGTAAGCACTCCAAGAAATAGACATTTTGTGTCGAAA
AAAAAAAAAAAATAGATTTATATAAATTTATAGGACTATTTCATAGAGAGAAAATTCAAC
TAGAAATAGGTACACGTAACCTAAAGCTGCTTGTACTAAAATCATAGCGCCCTGTATCAA
AAAGAAGCTTTTTTCTTTTGTTGGGTATGTCTATATAGAGCACATCCTATATTCCCTTCG
AGGTGTTTTTACAAGAACAAATAAAGAAACAAACCGCGGTGTGAGGAAGTTCCCTTAAAA
ATGGCAAAGATTACCGTAAAGGTAAATTACTCCTTTAACGATGCTTAAAACGAGCATCTT
ACTCTTGCAACGAAATTAATCACTCAATTTCAACGAGGATGTTGGCTTCCCATCAAAGTA
GTTTTGGGGTAAACCGCATATATCTGTATATTAAGAAAACTTATTTTCCACTATCTAATT
TGAACTACAGAGAAGATAAGAAATCTTTTAAGTAGCAATC
Chr coordinates Chr VII from 281157-280777
w3c xhtml validator w3c css validator