Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MET13
Systematic Name YGL125W
Alias MET11, MRPL45
Strain S288c
Description Major isozyme of methylenetetrahydrofolate reductase; catalyzes the reduction of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate in the methionine biosynthesis pathway
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET13 YGL125W
TCCAGGGCGCCCTGCAGGCGACGCAACCGAAAACCCCAAAAAACGTAACGGCCAGCGCTG
CCGCTGCCATCAATACTTTTATTCATGACCAGATGCACAGGTGGCAAGGTCCGTTAACCA
CCTCGGCACAGTGCAGACGTTTTGGAGGCCATTGGGCTGGAGGACACGATCCATCCGGGC
ACGTGTTCTTGGCCACCTTGATGTGCATGTTTCTTCTAGGTGAGCTACGTGTGTTTGGGC
GTCGTGCACTGGCTCACTTGTACGCGCAGAAATGGCAGCTTGTACGATTGGTGACCCGCC
TTTTCGACACTGGACCGCTATGGACGTGGCGGCGGTGTGGCGGCGGCTCAATGACCTGTG
GCGCCCGTTTGTGGCGTGCGATAGTCGAGCCGCCTGTCACGTGCGCGGCCGCCCTGCTCC
GTTTGACGCGATGCATAGCATGCGACCACCCAGTAATCATACTGCTGACGCTATTGGTCA
CGTGGTTATGGCAGCTGCTGTTGACTGCGGTGGCGTCCCGTTTCCACACCGTACGTGAGC
ACATGTCTGGATTGCTAGCTGCGTACATAGTGACAGGCCTTGTCTACGCTCGCGACGCAG
CCGCGCTACGTCCAGTATGACTCAGGAAAAGTTGGCGATAGACCACGAGCGACTGAAAAA
ATAACAGCGACTTTTCTCCCGGTAGCGGGCCGTCGTTTAGTCATTCTATCCCTCGGATTA
TAGACTGTGAATATTGCATATGCAACTTTGACTCAAATTTTTCCAAAATTTGATATATAT
ATATATATATATATGTTTGTATGTATATATATATATACGTATATATATCATATATACGAA
AAGTAGAAAAAAAAAGGTGATATTTCGCTCGTGGAAAAGCTAATGCCACAGCTTGTGTTT
CGTGTAGTTTGCCTTGCTCCCCTTGATTGAAATAGTCTCCCTAAACTAAAGTTATCAGCA
AACAGAACCACCACAGTTACTACTACAACCACATCGCAAT
Chr coordinates Chr VII from 272520-274322
w3c xhtml validator w3c css validator