Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SCS3
Systematic Name YGL126W
Alias FIT2B
Strain S288c
Description Protein required for inositol prototrophy, identified as an ortholog of the FIT family of proteins involved in triglyceride droplet biosynthesis; disputed role in the synthesis of inositol phospholipids from inositol
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SCS3 YGL126W
GATACTTCAGGGCAAGGGTCCTGTATTTGCGTTTAATTTGGGGCAAATCATCGTAGATGG
TATGGACGTCCAGGGGGGTCGGTAATTCTAATACATCATATAGGTTCAAACGTTGATTTA
TTACGTCTTCCAATTCGTGTCCTGGCATAGTCGTGGCGAGGCTTGTAGTACGGCGATGGA
CTTGCTTTTTGATTTTGCTTTCATCTTCTAATGTCTTGCGAGATAATATGCAAGGAAAAC
AAAGGAAAGAAAATACAAAGTAATGCGGCTTGCATATATATATACATATATATATGTATA
TATGTGATATATATATGTGTGTGTGTGTATATATATTCATGAGTGTATAAAATAGATATA
TGAATGCGTGCGAATGTAGTTATAATTAGGTGTGTTCAGTTGGCCCATCTTTCTACCATT
TCATTCATCCATTGCGGGCCTTGTAATTGAATGATCTTGGGCAGCTCGTCTAGCCCTTCC
AGCAGGCCATCTTCATTAACGATCGCCGACTCCATGAACCCGTTCAACAGCTTTAAAATG
AAGAGACAGTTTGGATACACAATGCATTGCGAATAAGGGGGGTTGCACCAGTACTCCAGG
TATTTCAAGTAGTTTTTGAAGTTAGGAGACTTCCAGATCTGCTGTTGAGTGAGTAAGTAC
GTTACGTATTGGATGTTTGCCAGTGACTGGATAAATTCGAGCTCCACTTCGAACCTCGTG
GGGAGAGGATTTTGATCCGAGGAAGGTGTCGCTGGTGCGTTTCCATTAGTGCTTGACATC
CTGGGTGGAGCTTGGGGGAACTTTGCCGTCTTATGAGTGCTATAAGTTTTGGCTTACTTT
GCCTCATTTTTCCTGCATTTCTTTTTCTTTTTCATCCTTTAAGAACACGTTAGCGGGAAA
ACCGTGAAATAAAATACAAAACGAACTGTTCGAAAAAAGCCAAAGGGGAAACGCCTAAAA
CTCCACTGAAACCAGCTATAAAGCACGGCATATTACAACA
Chr coordinates Chr VII from 270997-272139
w3c xhtml validator w3c css validator