Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEC27
Systematic Name YGL137W
Strain S288c
Description Essential beta'-coat protein of the COPI coatomer; involved in ER-to-Golgi and Golgi-to-ER transport; contains WD40 domains that mediate cargo selective interactions; 45% sequence identity to mammalian beta'-COP
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>SEC27 YGL137W
ATGAAGTTGGATATAAAGAAAACTTTTAGTAATAGATCCGATCGAGTTAAAGGTATCGAT
TTCCATCCTACTGAGCCATGGGTTTTGACTACCTTGTACTCTGGTCGTGTTGAGCTTTGG
AATTACGAAACACAAGTTGAAGTTAGATCCATCCAAGTTACGGAAACTCCTGTTAGAGCA
GGTAAATTCATTGCAAGAAAGAATTGGATAATTGTTGGGAGTGATGATTTCAGGATCAGA
GTCTTCAACTACAATACAGGTGAAAAAGTTGTTGATTTCGAAGCTCATCCAGACTATATC
CGTTCCATTGCTGTACATCCAACAAAGCCTTATGTTTTATCCGGCAGTGATGATTTGACA
GTCAAACTATGGAATTGGGAAAATAACTGGGCCTTAGAACAAACTTTTGAAGGTCACGAA
CACTTTGTCATGTGCGTCGCATTCAATCCAAAGGATCCTAGTACGTTTGCATCTGGGTGT
TTGGACCGAACCGTTAAAGTTTGGTCATTGGGACAATCGACACCAAATTTCACGTTAACC
ACAGGACAAGAAAGAGGTGTGAATTATGTTGATTATTACCCGCTACCTGACAAGCCTTAT
ATGATTACTGCGTCGGACGACTTAACCATCAAAATTTGGGATTACCAAACGAAGTCATGT
GTAGCCACTCTAGAAGGTCACATGTCCAATGTTTCTTTTGCTGTTTTCCATCCAACTTTA
CCCATTATAATTTCTGGTTCCGAAGATGGCACTTTAAAGATATGGAATTCTTCCACTTAC
AAGGTAGAAAAGACTTTAAACGTTGGTTTAGAAAGAAGTTGGTGTATCGCTACCCATCCA
ACAGGACGTAAAAACTACATTGCATCCGGGTTTGATAATGGGTTTACCGTACTTTCCTTG
GGAAATGATGAACCAACTTTATCACTTGACCCTGTCGGTAAGCTAGTATGGTCAGGTGGC
AAAAATGCCGCAGCTTCAGACATTTTCACTGCCGTCATAAGAGGTAACGAAGAAGTTGAA
CAAGATGAACCATTATCTTTACAAACTAAGGAGCTGGGTTCCGTTGATGTTTTCCCTCAA
TCTTTAGCCCATTCTCCAAATGGTAGGTTTGTTACAGTTGTTGGGGATGGTGAATACGTT
ATTTATACGGCGTTGGCTTGGAGAAACAAAGCCTTCGGTAAATGTCAAGACTTTGTTTGG
GGCCCCGACTCCAATAGTTATGCTTTAATTGATGAAACTGGGCAAATTAAATACTACAAA
AACTTTAAAGAAGTCACATCATGGTCTGTCCCAATGCATTCTGCTATTGATAGATTATTT
TCAGGTGCCTTGTTGGGTGTGAAGTCTGATGGCTTCGTCTATTTCTTCGATTGGGACAAC
GGTACGCTAGTTAGAAGAATTGATGTTAATGCTAAGGATGTCATTTGGTCCGATAACGGT
GAGCTGGTGATGATTGTCAACACCAATAGTAATGGTGATGAAGCAAGTGGTTACACATTA
TTATTCAACAAGGATGCTTACCTTGAAGCAGCAAATAATGGCAATATCGACGATTCAGAA
GGTGTTGATGAGGCTTTTGACGTATTGTATGAACTAAGTGAATCCATTACATCAGGCAAA
TGGGTTGGTGATGTCTTTATCTTTACCACAGCAACTAACAGGCTGAACTACTTCGTAGGT
GGAAAGACTTATAATTTAGCCCATTACACAAAGGAAATGTATCTATTGGGCTATCTAGCA
CGTGATAATAAAGTATATTTAGCTGACAGAGAGGTCCATGTTTATGGTTACGAAATATCT
CTAGAGGTGCTGGAGTTCCAAACATTGACTTTAAGAGGGGAAATTGAAGAAGCCATTGAA
AATGTACTCCCAAATGTTGAGGGTAAGGACTCTTTAACAAAAATTGCTAGATTTCTGGAA
GGTCAAGAGTATTATGAAGAAGCACTGAATATTTCCCCTGATCAAGATCAAAAATTTGAG
CTAGCCTTAAAAGTCGGCCAACTTACGCTTGCTCGCGATTTGTTGACAGATGAAAGCGCC
GAAATGAAATGGAGAGCCTTGGGTGATGCTTCCTTACAAAGGTTCAATTTTAAACTTGCT
GTTGAAGCTTTCACAAATGCACATGATCTAGAATCTTTATTTCTATTGCACTCATCTTTT
AATAACAAGGAGGGGTTGGTCACTTTAGCTAAAGATGCTGAAAGGGCCGGTAAATTCAAT
TTGGCTTTTAATGCATATTGGATCGCTGGCGATATACAAGGCGCTAAAGATCTTTTAATC
AAGTCTCAAAGGTTTTCCGAAGCCGCTTTCCTTGGATCAACATACGGTTTAGGAGATGAT
GCAGTCAACGATATTGTTACAAAATGGAAGGAAAATTTGATACTCAACGGTAAGAATACT
GTATCAGAAAGAGTTTGTGGGGCCGAAGGTTTACCAGGCTCTTCGAGTTCAGGAGATGCC
CAACCACTCATTGACTTAGATTCCACTCCAGCCCCAGAACAAGCTGACGAAAACAAAGAA
GCTGAAGTTGAGGACAGCGAGTTTAAAGAATCCAACTCAGAGGCAGTTGAAGCCGAAAAA
AAAGAAGAGGAAGCTCCCCAGCAACAACAATCAGAACAACAGCCGGAGCAAGGAGAGGCA
GTGCCGGAGCCTGTGGAAGAAGAGAGTTAA
Promoter Sequence
Download FASTA
>SEC27 YGL137W
CATAGGAATACTTAACGAATGTAGATAAGGTACCACCTTGGTGATTCTTCCTTTAATTGA
CCAAGATATTTTGTAATCTCTAATATCATCAGAAATAATAGGCGTTAATGGAATAGTTTC
AAAATTGTTCTGAGTGGGGGGATGCGTCTTTGAAGAATTGCAAACAAATACGAATCCAAC
AAATTTATTAGGAAAGTAAAGGGTTACATTACGCTGTGTATATTTCTGCACCCTTGCAAA
CTTGAAACATACTGAGCTGTTTTGGGAGATAGTATCATCCTCCTGGGCTGGAATGCATAG
TGGTTCTGCCCAATCTAAATCCTTTTGAAAGGGTAGAATATGATTCCAAATTGGCTTTCC
TCCTTTACAAAAGGTCACTTGAAGAAAATTATTGATTTGCAAGGGCGCTACCTGGTATTC
ATATTGTTTTTCAATTACAAAGCCTGTGTACAAAGTACTTTGTTTTTTGTATTGTTCGTA
CTCCTGCTTCAAGTTCTGTAACTTGTCACCTTTAAGAACATTTAAGAAGAACTCTGTCTG
GAAATTTTGGTCTTCGAACTTACACACATCATGTCCAGGAAATGAACTTTTTCCTTGAAC
GAAAGTGCTCTTAAATAAGGTGTACGTTATAAAAAAGAAGAAAAATTCTAAAAAGTTGTA
CATTCATCCGAGGAGCACTTTGGATATTATAATCTATTTTTAGTTTTGTTGCTTTGTATT
GAGCTGTATAAAAATCATTAGATCCACATTACTAATTATTGAATATGGACAATAATATCA
AATATATTATTATCAAATTGATTATTTTGTGACGCGGCGTCAAATTTTAATCGCGTCTGA
CGAATGAGCGGGTAATAAACTGTCTTTTTTTCATGAATGAATCGAGCTGGCATTAGGAAC
ATGTCGTGTAAGATTTGGGAGTAAATAACAGAAAGCTGCAATAAATGGTAGCTTGTAATG
GTGAATTAAGACACCCAATCGAAACAATTATACGGACACG
Chr coordinates Chr VII from 249869-249886,250087-252738
w3c xhtml validator w3c css validator