Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FLC3
Systematic Name YGL139W
Strain S288c
Description Putative FAD transporter, similar to Flc1p and Flc2p; localized to the ER; FLC3 has a paralog, FLC1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FLC3 YGL139W
CGCAAGGAACCGGCCGAAGATTGCGTAAGCTAGGCCAAATATCAATCCAGTTATGCAATA
GATAGCACCATGGATAGTACCCCCGACCCTTCTTCCAGGGTGAACAATAACAGAAATCAT
TGGCAGCATCGCAGGAGCTGCTCCCAAATGCGCAGTTATCTTAGGTATCAAGCAAAATAT
GAAAGCTACCGTAGTATTAACAGTCGATTTACATATTCTCTTCGCGAGGATTCTGTCACA
GGGGAAATAATACAGCCATAACTTCTGAATCTTAGTCAACTTTGATTTAAGCGACATGGA
CAAATAATGAAGTCAAGCAATTGATGCAAAGGATAAGGAAGATTTTCTCGCTTGAAAATA
TGTTCTCTTCGAACTCCAGGATAGGATAGGAATAAAGTAAAAATAGTGTATGATACGTAG
TTAGGCCACAACCACAATTATAACCTCTCGATAGCAGGTGTTAATAGAGATGAAGGTAGA
TCCTGGATTTCTCTTTTCTTTCTTTAGACATCAAACTGGTAGTTCTTATCAGTCTCAGCC
TTTTGAAGACCTATCAATTTTATGAGGAGGGTAATGGTTGCTTCCTTTTCCCTAGCAGCG
GCCCATCGCTTTAGCTTCAAATAGTTGATTCCTTTAACTGTTGACTATGAAAAGGTAGTC
TTCGTTGGGATTGGGGATAAAAGAATATCTGAATACTGTTGCTGTCCGTGCCATTTACTA
GCTTACGGACGCTATCAAATTAACTCAAAAACGCTTCTGTTCATCCGCTTTCCAGAAGAT
CAACGCTCAAAAGACAACAAAACAATTCGAAGACGTCATTCGTTATAGAGTGCCAATCAA
CATTGGTGGGTACTAGAAAACTTCTTTGCAAAGTATAGCTAAGAAAGGTCTTTTTATTTA
CGAGCGGGCCATAAATAAAAAAATTTCAACAACAACAACAACAACAACAACAACAACAAC
AACAAATAGTGGAGACTAGAAAAGTATACCCCTCACAGGC
Chr coordinates Chr VII from 245716-248124
w3c xhtml validator w3c css validator