Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LYS5
Systematic Name YGL154C
Strain S288c
Description Phosphopantetheinyl transferase involved in lysine biosynthesis; converts inactive apo-form of Lys2p (alpha-aminoadipate reductase) into catalytically active holo-form by posttranslational addition of phosphopantetheine
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LYS5 YGL154C
CCCATTTTGGCAAGAATCTCAGACGCAGATGGAATCGTATCTATGCCAGGTATACCATTA
GGAGATATGGAAAATAATCTGTTGTCCTGCGCATTACCGGATTCCATACGGTTATTCATT
AAGCTTTTCAGAGATTCCATTTCTTTTTGGATATTATTTAACTCTTGCATGCCGTCATTA
TCTGAAACAAATTTGTCGATCGTATTTTGCATATTGACCACCTCGAGTTTAACTATTCTA
AACTCGTCTTCGATCTTTTCCCTGCTTCTTGTTGTCTGCACAAGCGCCTGTTTCAGTTCA
GCAATCGTGTCACTAAGTTCCTTTAATGTTTCGCTTTCCTTTTTCCTAAACTCAGCTTGC
TCCGCTTCGATGGCATTGAGGACTGTATCGATTTTGGAGAACTGATCATCAATTTCTTTT
TTGTCCCCTTCCAACTTGCTTTTTGCTTCTGGTAAAATATTTGGTATCACATACCTTCTA
GTTACTTCATATGCACCATACAACAGCCCAGCTGTGGCAGTAGCCATCACAAAATAGTCC
TTCCAATCCCTGTGGGGCAGCGTTGGTGGCATCGCTTCATAGAGATACATATCCTGTGAG
GCTCTATTCTCAGTACTACCAATTTTTTTCGATACTTCATCGCCTACGATACCGTCTTTC
TTGGGCTCTTTCATGGCTATTTCAATCTCCTTTTCTGTTAACCCTTTGGATTTTAAAAAT
TCGATTTTCTTTAAAAGTGGAGCATCTTTAATGGACTCATCCTTTAAAAAGGATACTGCT
GAGTCGAACAATGCCTTACGATCTTTACTGACCACGTCACTCATTCCTTATTCACCTTAC
AACTTCTCTGTTTTACTTGAGTTTTCAAATTGATGGGCAATTTCTTATATTTTTAAGCAT
TGAATATATGTTTTACAATTATCTTTCGGGCGCTTATTAAAACCGCTATGACTAAAATGA
GAATGAGGAGAAAGAGAATCACTCAGCAAAAAAACCGTGG
Chr coordinates Chr VII from 216096-215278
w3c xhtml validator w3c css validator