Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RCK1
Systematic Name YGL158W
Strain S288c
Description Protein kinase involved in the response to oxidative stress; identified as suppressor of S. pombe cell cycle checkpoint mutations
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RCK1 YGL158W
TCAGACTGTGAAAACTTTGTAGTTCCAACTCACTTTGCTATGCAAGAAAATAATGAGGGG
AAACAAAAAAAAAATGAGAGCGGAGAAAAGAACAATGCAGCTCAAGTATGAAGAAGAAAG
TCACAGCAACGGAAATAAAAATCAAAATTGCGAAAATTGACAATCTTGACAATCGAAGCG
GAAAAACAATGGAAGGTCCAGATACCTGTTGACCTTAAAAATGCAGAAAAATCGCCTTTA
TACGGCGACATTGTGAAAAATGACGTTAAAATCTTGTACATAAAAAAAGGGAATTACAAA
CTTGTAGTGTTTTTTTTTTTTAGGGGACTTGCATGAAAGTTAAATTTTATAGAAGTAATT
AAATAGTCGATTTCCTTTCCTGTGTGTGACGAATCTAGATTTTTTTCATGTAAGAGACCC
CGCCCTGCGGAGAGGGGCAAACAATTCTAGCAGAAAAAAATCAGTGGAAAAAAAAAAGAA
ATTCCGGATATGATAGAATATTTCTTCGAGAAACCTTTTGGATGAGGAGTGCCCTTCCAT
GAAGAAATTCTTCCTGCATCAGCACCTTCCCGGCAAGGCATTTCATTTTTTTTTTCCGAG
AAGAAGATTTTTAAGTGGGCTACCCCACGCTTTCGGTGCCTATGGTAGCTGCATGATCAC
ACAATGCACTCCCATTAAGAGTTTGTGAAGTGCATGAGATTGACATCTCGGCGTCCCTTA
GTTTCCTGTCGGATTTTCAGTTATATGGAGTGGGTGAAGTCATTATCCGAATATTCGCGG
ATCATTGACGTATAAATACTTCATACTACTTCATACCAGATATTTCCTACATGTTGAAAG
TCAATTGAAAAAAATAAATCATCACTTAACTCTTTTCCAGTGACACATCGCAAAGATTAC
TCAAATAATCTTCCTAAAACAATACTACCAGCATCTATTTCATGCAGCACCAAGCACAGA
GGCTACATATCATATAAAATAAGTCATCATAGAGAAAAAA
Chr coordinates Chr VII from 207033-208571
w3c xhtml validator w3c css validator