Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HUR1
Systematic Name YGL168W
Strain S288c
Description Protein of unknown function; reported null mutant phenotype of hydroxyurea sensitivity may be due to effects on overlapping PMR1 gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HUR1 YGL168W
CCATTAATTTCAAGCCTTTGGCCTGGCCCATTAACAATTCTTTTGCCAGTTCCATCTTCA
GAGCATAGTGCATTATCAAAGTTAACGACCGCAGATCAGCCTACGTTTGCGGTACGCATA
CCCGCTAATCCAGTGGCTAGAGCACTGATTGCCCTGAGCGATACACCAATAGCTGCTCCT
TCAGCGAATGCGTCTACTAGGCCATCTCCTACTTTAGCGTCTCATGTTTATCATGATCTA
AAGGATAAAATTCCCATAATTCTTGATGGCGGAGCGTGCAAGGTTGGTGTAGAAAGTACT
GTTGTTGATGGGTTATGTAATCCTCCTACGCTACTGCGACCTGGCGGTTTTACATATGAA
GAAATTGTTAAATTGGGTGGTGAAGCTTGGTCTCTTTGTAAAGTTGAGAATAAGAAAACA
GTTGAAAAGGGCGAAAAGGTAAGAACGCCTGGTATGAAGTATAGACACTATTCCCCTTCA
GCTAAAGTTGTTTTACTAGTTCCTCATTGCGAAGGCGATGGCATTCTTAAGGGCGTTGAT
AGGATGGAAAGATTAAAGAGGTTAATCGAAACGGAATTAAAAGCCAACAGTAATATAAAA
AAAATTGCGATTTTAACTTCCCTAAAATTACGTGATTCCGACTTACAATCTAAGATCTTT
AATGAACCCGATTTTTCTTCGAAAACTTTCATCATCGAAAGACTTGGCCAATCTGGTGAA
GAAATACAGACTAACTTGTTTGCAGCTTTAAGAAAAGTGGATGAAAATGATAAAGTAGAC
CTAATATTTGTCGAAGGTATAAATGAGGAAGGAGAAGGATTAGCTGTTATGAACAGATTG
CGAAAGGCGGCTGCAAATAATTGTATACAGTTTTAAATAAAACTGTGATTAACTTTTGAA
AATCATAACCACTGATTACGGAGATTTTATATCTAGTCCGGAAAAAGAAGGAAAGAATAA
AATTTTATATTGCTTTGTATATACGAAAAGTCGCCCATAC
Chr coordinates Chr VII from 187464-187796
w3c xhtml validator w3c css validator