Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MND1
Systematic Name YGL183C
Strain S288c
Description Protein required for recombination and meiotic nuclear division; forms a complex with Hop2p, which is involved in chromosome pairing and repair of meiotic double-strand breaks
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MND1 YGL183C
TACTTGTCTCTAATGTAATGCTCCACGATGGCTTTGTCATCATCTCCATCAAAAGGAAAA
GGGACATTTTTAGGATTCCAGAACCGAGCATTCCCCTTATTGCCTCCAAGACTCACTAAT
TCATCGATATCCTCTCTTGTCCATCTATCCATTGATAGTGATTTAACGTTAGAAAAGGCA
TCGTCGTCTCTGCTACCGAAAACTTTTCTATGAACAGAGGCACACCTACCACAAAGGAAA
ACCCCCAAATTAACTGAGCACCAAGTTGGGTAGAAATTACCACATTCACCGCATTTATTG
GCATTCTCGGACGAATTAATCAACTCCTTTAATTCTCTGTCAACATGTTTTAAGCTATGG
GAAGAACTCCTAAACCTCATTTTTGACTAAGTATAAATAAACTATAATCTGTGATTGACA
GAACGCTGCCTCCATCTATATTAATGATTGATCAAGAGAAAATGTTCTTCTTCCACCCTT
TTGTGAAGCATTTAGAGATCAACACTAACTTTCTTCAACTTACAATAATTTCCGGGTGCC
CCCATTTATCGATTACCCGGATCCGCTTTGCATCATAGTGTGTCGTTGTCGAAACAAAAG
CGCCGTATTATTTGGTCAACGTTTAATAAAGTAAAAGCAGCATTTGAGATGCTCTATACA
ACCTTCTTAATTGCAACCGACATAAAGGTATGTTTTTCTCTTCTTATTATGACAAGGGAA
ACTTGAAGAAGAATTCGTGTCTTGCCATAATTTCAGCATCATCGTCTCAACCTAAGCCTC
TTCTCACGAAGGCACGCTCAAATATCTTTCTGGCTCTAAAAATCTTGAATAACGAACCGA
ATTTACCATCTTTCCTGCTTTTTTATGCGTCGAAAAAAAGTAAAATAACCGCCCAGATCA
CGAAATTGCATATAAAAGGCGATCTCCCGTCCCACCGTTATTCTTTGCGATATAGACTAA
ACGGCGGAAACTTTATGTGTAGTATCATAAACATTCAACA
Chr coordinates Chr VII from 157199-156543,157285-157283
w3c xhtml validator w3c css validator