Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TPN1
Systematic Name YGL186C
Strain S288c
Description Plasma membrane pyridoxine (vitamin B6) transporter; member of the purine-cytosine permease subfamily within the major facilitator superfamily; proton symporter with similarity to Fcy21p, Fcy2p, and Fcy22p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TPN1 YGL186C
AAAGAGCGGATTTGCTTTTGGCCATGAACTGGGGAATATGTTTGCTGAATCACCAAGAGG
AAAGAAATGCTTAATTCTTGGTTTAGGAAGTATTGGAAAGCAAGTAGCCTACAAGTTGCA
ATACGGGCTAGGAATGGAAATACATTATTGCAAAAGAAGCGAAGATTGCACAATGAGTCA
AAACGAAAGCTGGAAATTTCATTTGCTAGATGAAACAATATATGCAAAACTATACCAGTT
TCATGCAATCGTGGTCACATTGCCGGGAACTCCACAAACAGAACATTTAATCAACAGGAA
ATTTTTGGAACACTGCAATCCAGGCCTAATTTTAGTCAACTTGGGAAGAGGTAAAATTTT
GGACTTGCGGGCTGTTTCTGACGCCTTGGTAACGGGACGAATCAACCATCTCGGTTTAGA
CGTCTTTAATAAAGAACCAGAAATAGATGAAAAAATCAGATCTTCTGATAGACTTACTTC
AATTACTCCGCATTTGGGTAGTGCGACAAAGGATGTTTTTGAGCAAAGTTGTGAACTGGC
ATTGACAAGAATCTTACGGGTAGTGTCTGGGGAAGCCGCAAGCGATGAGCATTTCTCCCG
TGTAGTTTGATAGTAAGAGACGTAAGAACCTTATGTTAACATACCTATATATACATATAC
GTCAACACACCAAGAAAAAAGAGCAGTGCGAGTTTTCGTATGCATTTGACTTCAAAAAGA
AGTCAACATTAAGTGCCGTTTTTGTTTCGACAATGGATTGTAGTACAGTGCCCCGTAGGT
GTATGACTCGTACTTGCGTGTAAGTAAATTTCGGATTTGTTCGCCGCACCTTATCTCACC
TGAAATTTTCTGCGTCAGGCTGCTTTGATGGTGTCTAAGAGAAGGCCATTAAAAAAGAGA
ACAGATGTTGAGGTTCTCAGTATAAAAATATTACTGTTGAATATTATTAGCTTTATAGAG
TATTTATCAAAGAACAGGACTTGAAAAACTTCGATCATAG
Chr coordinates Chr VII from 152776-151037
w3c xhtml validator w3c css validator