Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HOS2
Systematic Name YGL194C
Alias RTL1
Strain S288c
Description Histone deacetylase required for gene activation via specific deacetylation of lysines in H3 and H4 histone tails; subunit of the Set3 complex, a meiotic-specific repressor of sporulation specific genes that contains deacetylase activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HOS2 YGL194C
GTTGTTCACGTGGTAACCCCTGGTTGCTGACGTTAACGTCCCAGTTCAGGACTCCAAGCA
GTCTACCCAGCAGTTGGTCTTTTTCCGAATCAGCTTCCGGTTTTGTTGTTAAACTCGACA
CTTTTTCTTCACATGAAGAACTGGACGATTTTAATGTATAGTAGAAGGCATGGAACTTGT
TATAGAGAATTTTCAAGGAAAAAACGTCCAGGTAAACAATTTTTTCTGGCCTATCTGCCA
CTAATAGATTCTGGTCAAATTGAATGGACTGCGGCGTTGCAAATATAATATCCTGAAGAT
CATTCCAAAACTGTTCAAACTGTAAGACCTCGTCTTTATCGTTTCTCAACTTCTGCATCT
CATCATCGTATCCGCCACTGATGTACAGTGAATACACATCTTTGAGCTGTCCAGAAAGCG
GTGCTCTTAGGATGTCATCATAATTCTGGATCAGAAAATGTACTAGTTTATCGTTAATCA
TAGCCTGCTTACAACTTTTATGAATTCAAGTCTGAATGCCAATTCTTATTTTTTTCGAAA
ACCCCCAATGCTAACTTATATGGTCCGTTTTCTTTACTGTTATCCATCTCCCTTTCCTAT
AGCTCCAGCGGTTACCGATCTTCCAGAATGCCGGGGAGATCTTTCTCTTTCTTTGTTTAT
AACAAGTTTCACAAGCACGAAAGAAAGAACAATACTGTACGCCAAAAGCCGCCTAAAGAC
GCATATTCCCGTCAATTTATGTGACCGGTACCACTATATACCTAAGGCACCTCTATACCA
ATGTAGAATGCCCTGTTTATACTCTATATAGAGGATTCTCGATGTTCTTTGGGGCATCGT
TAAACGTGATATTCCTACTATGTTACTAAATGTTGAACTGAAAGCATCTTGAAACGATTC
TAATCAGTTTTAGGTGTGTCGCCAATGTACAGTTATAGAAAAGACGCCAGATTACTCAAG
TACGTTAAAATCAGGTATCAAGTGAATAACAACACGCAAC
Chr coordinates Chr VII from 141726-140368
w3c xhtml validator w3c css validator