Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EMP24
Systematic Name YGL200C
Alias BST2
Strain S288c
Description Component of the p24 complex; role in misfolded protein quality control; binds to GPI anchor proteins and mediates their efficient transport from the ER to the Golgi; integral membrane protein that associates with endoplasmic reticulum-derived COPII-coated vesicles
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EMP24 YGL200C
ACTAGTGTTATAAAATAGTTGACAACCAGGCCATGCCAAAAAGACAGAGTGCCAGAGGGT
ATATCTCGATAATGGTCTTGCTCTTGGTAACCCACGAAACGGCGGCCACAGACCACATCA
GGCACAGCGCCATGACCACCAGTTTCACGAGCGACAGGACCCTCACAATCCAGCGATTTT
GCTTTCCAATATGGTAGGCCAATGGAAGTAGTATCTGCGAGACTAAGGCATTCAGCACTT
GTGGGAATAAGCAATACCCGGAAATGGAGATGTACGAAATCAGCGACACCCTCTGGTGTG
GCTTGGTGAGTCTCAGATGCAATGCCATCACCAGCAAAATGAACCAACTAGACACAAATA
GGCTCGAGAACAGCGACCGCGCATGCGATACAAATAGAGAATACAATATGATAAACGCAA
GGGGCGCCCACAGGTCGCAATTGGCTGAAATGTCGTTATCAGCCGCCCCTATCCCGTCAT
CAGAGGGGCTAAAGAATGAGGGGAAATGCGGGTATACCACTTGTTTCAGTCTGGAATTAA
TCTCCACCACATCTCGCTTTAGTGTTTGCAGCACAGTCTCGTCGAGCGTCCCTCTGCTGC
CTGAATTCTGCATAGTTCCGCCTATGTTGTCAGCAACACCCCCGGAAGCAGCCAAAGGTG
CATCTGGTTCTATGAAGTCGGGCTCAATCGTAGTGTCTTCTCTTCCGTATGACATTTTGC
CTGCCCTCTTGTGACATATCTTTCTACAAATATTGCTAAAACAGCTTCATTTGCTATTGT
AAAAGGGGACGAAAAATCACTGTGAGAAAATCATCACTCCGGGTAATCCAATTTTCATGA
AAAAAGACGCGAGGAAAGTCAGAAAAGTCGTGCAAAACAGCCTGAGAGATCGGGTCGCTT
AAACATTTTGACACGAAACTTATAATGAAATAAAAAGCTATACTTGGTGAAACTGCAATC
TTAATAGTATCCCTCCGCACAAAAATACACACGCATAAGG
Chr coordinates Chr VII from 123305-122694
w3c xhtml validator w3c css validator