Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARO8
Systematic Name YGL202W
Strain S288c
Description Aromatic aminotransferase I, expression is regulated by general control of amino acid biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARO8 YGL202W
TGAAGTGCAAGGATTGATAATGTAATAGGATAATGAAACATATAAAACGGAATGAGGAAT
AATCGTAATAATATTATGTAGAAATATCGCTTCCCCTTTGAGGATTCCTCTACCCTCGAG
GAGAACTTTTAGTATATTCTGTATACATAATATTGTAGCCTTGATCAACAATGAAATGCC
TACAATCATCTTAAAATTCACCAATCTCTCAGCTCTTATTTAAGCTTTGTTGAGACGAGA
GTTAGTTATCCGACAATACTATACAAGACATTAACATCATTTTTCGTGCTGTTAGGGTGG
TGTCTTTTCATTTGTTGCAATAAATGATAAGTAGTTTACCGTCCATTAACATGTGCATTA
AATAATAGCATTATGTGAACATAATGTATATTTAACTAAAACTATTATCGAAGAAATCCG
AAGAACTCATCCTTGTTAGCTCAGTTGGTAGAGCGTTCGGCTTTTAAGCGCATTTGCTTA
AGCAAGGATACCGAAATGTCAGGGGTTCGAGCCCCCTATGAGGAGTTCTTCTTTATTTTT
TTCCCGGTTCACTATTTTTCCAAGATTAAACATGGCTCATATACACCATCCAAAAATCTC
TTAATTAACCTATAACCATTGTTCTCCTTCACCTCATTCAAGAATCTGGCTTCTGAATTG
CCATTGATAGAAGAACAGTACTAAATTGCGCCGGAATAATGAAGAACATCCGGGTTACCT
TAGATGTCTTTTTTTCCTTTTTTTATCACATTTTTCACTCTGCACTTTTTCACTTTCTCG
AGGTCCAATCTATGACTAATATTAAGCGCATTTCATTTGAAGATATGTGTATCGCAATCT
TTTTTCTTATCTTGTAGACCCTCCTATACACATCTCTAGACTATATATTTGGTTTGGTTA
TATCTTTAAGAACTTATTTCTTTTTCTTATTTTTCCATTCCACTAAGTTAAACCCTGCAG
TTGATACAGACATTGAATAGGACAACCGATCGTTACTATC
Chr coordinates Chr VII from 116059-117561
w3c xhtml validator w3c css validator