Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KIP3
Systematic Name YGL216W
Strain S288c
Description Kinesin-related motor protein involved in mitotic spindle positioning
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KIP3 YGL216W
AACTGAACGTCATAGTTATAGGAATTGTGAACGATCCATTATTGATGAGCTGGGGCATGG
TAAAGCTGGGTGTATCCTGTTCGTTAATCAATAAAAGATTCGACTCTATGACTGTCTGTA
TCCGCAACATAGCATCCTTACATGAAATCTTGCAAATCCCCTTGGCCAGAGACTTGGGCT
GCGTGATAATGTCTAGGTCCAGAATTTCTAGCTGTGGTATTGTAGGAAAATCCACCTTCT
GTACCTTAATTCCGCTTTTCAAGATATCTAATTTCTTTTTAGACGGTGAGTTCAAAGCCG
TAGATAACTTTTCCCGTATTCGTTCATTGAAAGAGTTATCACCAAACACAGCTTCGTTGA
ATCTAAATGACATGACGATGCTGAAGTTTCTTGCAGTTGTGTTTTTTTTGTTATAATTGT
TACTGTTTCTATGTTTTACGAATCTTCCATGACTCTTCTAATTGGTCTCTTTTTACTACA
AGGCTTCATGGCCCTTTTTCAAACCTAATTTATAAGTTCTTTGCCCTATGCTTAAAACAG
TTTAGCCCTATTTAATATAGTACAAAAAAGGAAAAACCTAATTGAAAAAAGCTATTCACC
CTAGGTCATTACTACTTTTTCCCTTAGCTAGCCGTGTTTTTAGTTTTTGTTTTGTTTATT
TTACCTGTATTATGCCTTGTTTGATGACTTTAGTATGGGTTTGGTTTGTCTTATCCTTGG
ATACAAAAGGACCAGATACATTCACGTCTGGTCGGTAGAACATCGGTATCCAGTATAGTG
TTCAGCTGTTCCTATAGAGACAAAATTTATAATCTGCGTGTAACAAATATCTGCAGGTTA
AAAAAGTCCAGATCAGTGTTTCGAAGCTGTTGATTTTTCTTTTTTTTTTTTTATATTAAA
ATTTTCATATTCCCTGATTGCATCGTTTATCTGATTATCATTTCATTGCATTCTTTAACT
ACTTGAGTTTTCTTTCCAGCTGTATACTATTGACACTAAC
Chr coordinates Chr VII from 84885-87302
w3c xhtml validator w3c css validator