Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EDC1
Systematic Name YGL222C
Strain S288c
Description RNA-binding protein, activates mRNA decapping directly by binding to the mRNA substrate and enhancing the activity of the decapping proteins Dcp1p and Dcp2p; has a role in translation during heat stress
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EDC1 YGL222C
TCATCGATTGTTCCACTGCACAAGTCACCACTGCCGATGCAAACGCTAAAACAAAGGTCC
TTTTGACTGTAGACCTCACGAAGTCAGTTGCTCAAGAAGCTGTGGATGCTAACTGCAACG
TAATTGTTGCTTACCATCCTTTTATTTTCCCAAGCTGGAACAGATTAAGCCCACATACAA
ACCCACAACACGAGACAGCTATAAAGCTAATCCAGTACGGAATATCCGTATACTGCCCTC
ACACTGCCGTAGATGCCGCTCGTGGCGGTGTAAATGACTGGTTGGTTAGGGGTTTGAACA
ACGGAGAGAACGTCGCAAAGTCTTATGCCTTGGAAACTGTAAGTGGCGAAACTGACGACT
TGATTGGCTACGGTAGATTCGTAGAATTCAATAAAGACATCTCTTTGGAGCAAATTGTCA
AAAATGTCAAGCGTGTTTTACGGGTTCCCTATGTACAAGTAGCATCTCTTGCTGCTCCAT
CCGCATGGAATCAACTCAAAATCAAAAAAGTCGCTGTCTGTGCCGGGAGCGGTTCTGGCG
TGTTTAAGCAACTAAAAGAGGACGTAGACCTTTACTATACGGGAGAAATGTCACATCATG
AAGTACTGAAGTGGAAAGAAATGGGCAAGACCGTTATTGTTTGCAACCACTCAAATACTG
AGCGTGGATTCCTTCAAGACGTTATGAAGGGCTTGTTGCAAGATGAGGGCCACGAAGTAG
TCGTAAGCAAAATGGATTGCGATCCTTTGACTGTTGCATAGCTGCTAGTAATTATATGGC
TATATAGGATATCACAAATACCATACGTACTACAGTTTTATCATCCGGCTGTTCGTGTAA
AATGATGTTGTTGTATCGGATAGAGAAATACGGATAGAAAAGGTAAAAGTCTTCAAATAA
CAAGGACAATAACATACTCTGTATTGAAGACGAAGTACTCAGCAAAGCGTAACGTAATTA
CACTTAGCACACAAATATACTCACACAAATATTACAAGGC
Chr coordinates Chr VII from 81186-80659
w3c xhtml validator w3c css validator