Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VRG4
Systematic Name YGL225W
Alias GOG5, LDB3, VAN2, VIG4
Strain S288c
Description Golgi GDP-mannose transporter; regulates Golgi function and glycosylation in Golgi
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VRG4 YGL225W
GATCTCAAGGAAAAAAATGCAATGTCGGGCGCCAATACTTATGATCATGCTTAGTCTCGA
CATTGACCTTGCTTGCTACAGTAATCTGGTGTCCGAGTAGTGACATCTAGGTACCGGTGA
GAACTATATCTTCATTACTACACTTGTCGCCCCTGAATATTATCGCTACACACGCGAAAG
AGCTCTTGTTAAAGTTACTCTCGCATCATTGCGGTACATGTTTTGCATATTCATCTGAAG
TAGGAAAGGGTATAAGCAGTATATGATGTACCATCTGCATAAGCGGTGTTTAATGCGTAC
CTATCGTTTAAGAACAAAAGGAACACACCCACACCCGCTCCAATACCATATTGAGAGAAT
AATGAGGTAACATATGCTTCTATTTGGTTCGATAAGACGGCTACTAGTCCAAAAAAAGTC
AAACAACAATTTCAACAGCTACATTCTGAAGATAGAACGCATTTTTGCCTGAATATTGCA
ACTCAATAGACATTCTAAAGTGCTACGAGAAAAAAGCTTGTAATGGACCATGGCAATGTG
CGCCATATATATATGCGGCTCCCTTATGAGTAGAAGAAAATATATGACTGGTGGTACAAA
GTGGCATGGTGGTATATAGATGTAGGAACACCATTTGAGTTTGCCATAATGATTAAATTT
CCCTTTTTATAAAGAATTAGCCGCCCATAACACGAAAAATATCACAGTTGACGAAAGAAG
ACACGTCGCCTAAACGCGTAATGAATCGCAATATACGAAAAGCTAAACGGGTTTTTCAGA
ATCCTCTTACCCAGCCTTGGATAATAGTTTTGGCCGAAAAAAAAAAAAAGAAAGAAAAAA
ATTGAAATTTCGCGATCCGAACAAACAATGAACAGAAAAACAGAATATATATAACGCTGC
CAAGCCTATTTCTTGTTGCCGATTAATTGTTGACATCCTCTTAATTACCAAAAGAGCCTA
AGAAAACAAACACACTAACCACACAGTATCTTTCGCCCGA
Chr coordinates Chr VII from 76894-77907
w3c xhtml validator w3c css validator