Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SAP4
Systematic Name YGL229C
Strain S288c
Description Protein required for function of the Sit4p protein phosphatase, member of a family of similar proteins that form complexes with Sit4p, including Sap155p, Sap185p, and Sap190p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SAP4 YGL229C
TTGACCATTGGGGAGCGGACCAATTGGTAATACTTTCCACAGTTCCATTTCTTACATTGT
GAATGGATGACCTTGAATGCAGGCTGTATAGCGACCTTGTTCACTTTTACTGTAGCGTCA
TCGATGACAGGTTTGACAGCCGTGTCATATTTACGCGCCACTATATCGAAACCGGGACTA
ACTTTATTTTTGTATAATTCACAATTTCTTGAAAAGTAGGTGTTCCAGACTCTTGGATTG
GTATAATGGCAAAGCGTTTGCGTGCGTTCACACGATATGCTCCCACTATTGAATTCGCAA
CAGTACTGAAGCAACGATACCAACACCGTCAGAGTTGTGATTAACTTTATCAGCTTTCCC
ATTTCGTTACGCTGCGTTCTTGTTTAGATGTAACAGCTTTTGTGCATCCAAGATATAAAG
TACTTCAGAAATGGTGGTTGAAACAGAATGCCCATTACGCTTACTTTAAGGCTGTTCTTC
AAGTTGATCCTTTCTTTGATACATGATTATCATCATGTACGTAGAAATCCGCCTTATTTC
CGAAACCTGACTATCTTAGGGTTATACATAGAAACGTATAGGACATTTCTTACTTTTGAA
AATTGTTCCTTGGGCAGTTCAGGGTTTAGTTAGGGTATTGATGCCAGCCCTAAATCCCCT
AAATAAGAACTCTCGAGGATAATAACAGACAATAAACCAAGAGTTCATCCACGTATGATG
GCTGTTTTTTATTCTGTCGGTTTTTGGTTGCCGTAGTAAATATAATTTGGTAAGCGTGTT
GTGCTGTGTTGTGTTGTGTTGTGTTGTGTTGTGTTCTACTAATTGGATTGTGCGAATAAG
TGAAACGGTTGCTTCACCCAGCGGGAAAAGGACAACCTGGTATTTGGTGTGAGATAAAGT
TATAGACAATCTGGTCTTTTGTTATTAAGTTCTCTTTTCTTCTATACCGTCCAGTTTACT
GCTCTCTTGCTTTTCGATAAAGCTAAAATAAAATAAAAAT
Chr coordinates Chr VII from 66959-64503
w3c xhtml validator w3c css validator