Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADE5,7
Systematic Name YGL234W
Strain S288c
Description Bifunctional enzyme of the 'de novo' purine nucleotide biosynthetic pathway, contains aminoimidazole ribotide synthetase and glycinamide ribotide synthetase activities
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADE5,7 YGL234W
ATCAGTTACTTTGCCCATCAGCCCATCGAGAGCGTCGATTTCCTTTACAAGGATGCCCTT
ACCCACTCCACCAATAGAGGGGTTGCACGAACACTTACCAATATCTGTTAACGATGGTGT
AATGAGAGTAGTATGCGCACCAGTCCTAGATGACGCAGCTGCAGCTTCGCAGCCTGCATG
TCCAGCACCGATGACCACGACCTGTGTCTTGGTTGTGGGTTGGAAGCTTGTCAAAGAAGA
TATGGTCAACCGCCTCCTGAGGACCTGTAAGGGAAATGAAGTACACGAAGACGCCAAGGT
TGTTACACGCAGCATCGTTCTTTGGGGCGTTTAGCTGGTATTCTGCAGAAACTATTGGAT
GCCCTCAAGATTTAAGTGAAGAATTAAACCGCACTTATCCGTCTGTGAAAGATGCCACCA
TACGTTACCAACCATAAAGAAAGTGGCCGCACACAGGTACCTTAGAGAAGCCACAAGGGC
TCGATTACACGGTGGCGATCAAGAGCCATACAAAAGTAGAAGACCCCCGGATGAAGAAGC
ACCTCTTTGTACGTTCCTTCTGCAACGCCATATCTAAGTAACAAGAAAGAAGCCACAGCA
TTACTACAACCCCACACAGGGACAGACAGATATCATAAACTTGAATCTACTATATCATAC
TCTAATAACTACCTAAGCGTTAAGAAATCGTCTAATCTTCAACTGCCGTTGTTCATACCG
TGACTAATAGTGGCAGTAAGCAGCTTTTTTTTTTTTTCAAAATTTTTCATTTTTTTTTTC
AGTTGACTCGCCCCGTCGGTAGTGACAAGTGCCGACTGACTCGTGTCCTGGTAATAACAG
CAATAATGAATATGCGATGGGCTTGAACTTGGTATTTAAACTATGTTCAGAGGCAAGTGC
AACCGCTGTTAACCGTCCCAGGAGCTACCACTAGTAGCGCAGTTATTTCTTATTACTTTC
TTAATCATAGCTTAAGAGAACCATTCTCCCTCCCCTCACA
Chr coordinates Chr VII from 56482-58890
w3c xhtml validator w3c css validator