Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADH4
Systematic Name YGL256W
Alias NRC465, ZRG5
Strain S288c
Description Alcohol dehydrogenase isoenzyme type IV, dimeric enzyme demonstrated to be zinc-dependent despite sequence similarity to iron-activated alcohol dehydrogenases; transcription is induced in response to zinc deficiency
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADH4 YGL256W
TTCGATAAATACTATTGGGGCTACTTTTGTCCTGTCACTGCGGATTTGCAAACACTCATG
CGAATATTTTACTCAATTGAGAGATTTGCTGTCTCCCCCCACTTCGATGGTCCCCACCCC
TAAAGTAAAGGAAAGAAGAATTAGCACTGTTTTAGTTCCAGGTACTTCTTTCTTTCTTTA
CCGGTATTGTGTGGCTCATCAAAACTTCGTCTCGGGAAAATGAAAAATGTAAACAAGAAT
TTCCGTTTCAAAGAGTTGCCTAAGGCCCACTAATAATGTACTTATTATTTACAATTCGGA
GAACGCTGCTGATAGAAATCAATCAAGAAGTCCCTTAGTCTTTGTGTGTTTACGCCATAT
TGCTTAGTTTCGTAGTGCGTTACAGTTCTATCGTGTGAAAATTTTTTTCTAATGCATCAG
CTGTTATGCGCACTACTTGAAAGGTTATCGAGCGTTTGTAAAAAGTAGAAGTACTTAAAT
GAACCTTCACGGTTAAGCAACCAGTATAATTGAGGCTGCTGATTTGAAATTGCGTTTTGT
GTTCAGAAGGATCCCCGGAGGCCTTCAATGAGCTTCCATTTTATTTTCTCCAAGGAGGCC
ATTTTTTGTAGTGTGATGTTGACATGGTTATAACTGTTAGCAGTGTTTGTGATGATGGCT
GTAGTATCACCGCAGTGGATTAGCTATGAAAAAAAAAAAAAAGAACTAGTTTTTAGTTCG
CGCATCACGAGGTACGTGTTTAATATGTCAGATGCTTGGGATCACGTATGCCGTTAACTC
TACAAAGCAATTGATATTTTGCTGCCTCAAATATCTCACACTACTAGGATATATTCTTTT
ATCAAACAGGAAAAAAGGGCAGCGTACCAACATGTATAAAAGGGTTATTAGCATTTCTGG
TTTATTAAAGACTGGAGTCAAACGTTTTTCTTCTGTCTATTGCAAAACAACCATCAACAA
CAAGTTTACATTTGCAACAACTAATAGTCAAATAAGAAAA
Chr coordinates Chr VII from 15159-16307
w3c xhtml validator w3c css validator