Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VEL1
Systematic Name YGL258W
Strain S288c
Description Protein of unknown function; highly induced in zinc-depleted conditions and has increased expression in NAP1 deletion mutants
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VEL1 YGL258W
AGTTTTACAAGTGTAAAATTCTTCCGTAGAGTTTGAGGGCAATCGCAAAATTTCCGGAGA
GTCCTTGATAAATTATTACAGTGAAAACGTATATGAAATGTTCCAATTGAGATATCTCGC
TTATATTAATACTTCTTCTTTCTTTTACCATATATTTTCTAATTGGCCGCTCAGCTATAG
CGATCTTTACATGTATACTTTGAAGTTTTTTTAAACAGTGCACCCGTGCATCATACCTCA
TGCAAGGTACCTTTTTTTCTCAAAGGTATTGTCTTCTATTGAAGTGGCACTATGGCATGA
TGAACCCTGAGCATTTCCGAATTCAACAGAACCAAATTGTCCAGAATTAAATCTGTCCGT
CATGAAATAAGCAACTTTTTTTCAATCAAGTGAAGTGAGTTTTGCAGTATCTTACCATTA
TTTTGACCTATTGGCCGCATGTTTGTGCTTTGACTTCGAGAACCATGTTAAAGCTTACTT
GTACGACAACCAATGAAGTACATTACGGCAGTTTTTTGGACTGGGTCAAAAAAAGTGTTG
CATAATCAAATCAGGAACACATTAAAATGTTATAAAATTTGTCTTAGTATGACCTGAGTG
GTTATTCATTACGTACTACTGTCAAAATATTCGGATCTTTCCTAAACGGGCTTTTGAATT
AGTGTTGCTTCTATTCCTGGAATGGAAGGTAGTAATTTCATGCATTCTCGCTTTTCGGAC
TTTTAACAATAAATTAAAAACAATGATACTTTCATCAACTACCTATACACCCTGCGGGTC
AATTATTTTTTTTTTCGAATAACCGCTGAGGTTGGAAATATAGAAACATATTCCAGATCT
GTATTTTCAGTTGCTAGAAAAAGGTTAATATTATCATTAAGGTTTTCAGCATATAACAGG
TATAATTGATATATAAGCATCGTAATTTTCATTCAAAATGGAGAGCTACTGCTTCTGATA
GATTGTACAATCTCAAGAAATCAAGAACAACAACCATACC
Chr coordinates Chr VII from 11110-11730
w3c xhtml validator w3c css validator