Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGL258W-A
Systematic Name YGL258W-A
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGL258W-A YGL258W-A
GTAATTTGTATAAGGGGTTAAGGGTCCAAAAATTTGCTACCCTATCGCTCACTATAGCAA
AATATCTCGAGAGATATCCGAGGAGTTAAAACTGACTAGACCTGTTGCGTAAACCTCATG
CAAGCAGTACTCTTCGAGGATTTAAGCTTTGGAACTGCTTTCAAAGTTGAGAGTATATAA
GGTGTTATGATCTTGGAATAAGGTTTTTCATCGTTCTTCCTTGTTCTCTATTTTCATTGG
TTGATCAGTTGTTAAATTTTGTCTCTTTCGAAAATAAGGATATTTGAAGACAACGCAACG
CTATCAATATGCAATTGTTTTCCATCCTCTCTTTGTTGTCATCATTGATGTGTTCATTGA
CCGTTTTAGGGTCTTCCGCAAGTTCCTATGTTAAGTTTCCTGTTCAAAAGTTTGCTGATA
TTATAAATATAGGCACACAGGATGTTTCTACCGTCTTCAAAAGAAATGAGGTTCTTAACA
CCACAGTGATAAATGGAATAGGAGTGTATGTTGTCAAGATGGAAATCGGAACGCCTCCAC
AAACGGTGTACCTACAGTTAGATACTGGCTCTTCAGATATGATTGTGAATAATGCTGACA
TTGCCTATTGCAAATCGATGTCTGACGGATCTGACTACGCTTCAACTGATAATTACGAAC
TCACGGCAACATTCACTGGGCCTCGTTCTACTACCACCTCACCAGAGCTTATAACACTGT
CCGCTCTTATAGGGGTAAATTCAATGCAAGAAACTCATCTACTTTTAAGAATAACGCGAC
TTTCTTCAATGACATATACGTATTAGAAGGAACCTATGGTACGGACGTTGTCTCTTTAAA
GAATTTTTCACCTTAAATAATATCATTGTTGGCCTATTAAATTATAAAATGGGCAATCCA
AGTGGCATTTTAGGCATATCCCTTCCCCTTGCAGAATTTACAGATAATGTTGAAAATGCA
TTTGCTTTGAACAGAAAACTCTTCGTATATGAGAATTCTA
Chr coordinates Chr VII from 9162-9395
w3c xhtml validator w3c css validator