Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGR039W
Systematic Name YGR039W
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the Autonomously Replicating Sequence ARS722
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YGR039w_YGR039w	YGR039w unspliced ORF sequence, from start to stop, size 312
ATGTTATTTTTTACCGGCTTAGTAATACTGAGCTACTTACTTGGGGGAAAGAAAGATTGG
CTACTTATTATGTATGAAGCCTCAGATTACCTTGAATTCCTCAACCGTTTGAGCAGTATG
CTCTTCAAATTCGAACTTTTTGAACATCTTTCCTCCACATTCCTGATTTTTTCACATTCA
AAACGCGCTGTGAAGCTGTTAGAAATTTACAGATCGAGGCATATTTCTATATATAATGTA
TTTTTATTAAGACACCCAAAGTACTTCCAATCTGTAGATATTGCACTTTATCTGACCAGA
AGCCAGACTTGA
Promoter Sequence
Download FASTA
>YGR039W	6321476 upstream sequence, from -1000 to -1, size 1000
TTCTGATGTTAAAGTGTGTGGTGGTAAGACGTTATTTCCCACCTTTGTCTTAGCTTGAGG
TATTTCAGAGTGTTGATTTTTTAAATCGATTGGATCAGGTGAGGAAGTACTCAGTGGTGG
GATATACTGTGGCAACGGATAGTGTGGGTCCGGTTGATAATACGCAGGTGACGTTTGATA
ATGTGAACACGTCATCATAGATGGTTGTTGGTAATGTGCCCAGTTAGAGGCCATAGCTTT
GTTTGGGGTCATCATGCCGTGCTGTTGGTACTGTCCATTCTGTGGAGGTGGTACTGAAGC
AGGTTGAGGAGAGACATGATGATGGTTCTCTGGAACAGCTGATGTCCCAGGTGTTGTCTC
TTGTTGAGAATTAACCTTAGTGGAATCTCTATCAAATTCCGGTAAATTGGAAGCTGAAAC
GGCTAACGGATCTTGATTTTATGGGACTTCCTTAGAAGTAACCGAAGCATAGGCGCTACC
ATGAAGAGAATGTGGATTTTGATGTAATTGTTGGGATTCCATTTTTTATAAGGCGATAAT
ATTAGGTATGTAGATATACTAGAAGTTCTCCTCGAGGATTTAGGAATCCATAAAAGGGAA
TCTGCAATTCTACACAATTCTATAAATATTATTATCATCATTTTATATGTTAATATTCAT
TGATCCTATTACATTATCAATCCTTGCGTTTCAGCTTCCACTAATTTAGATGACTATTTT
TCATCATTTGCGTCATCTTCTAACACCGTATATGATAATATACTAGTAACGTAAATACTA
GTTAGTAGATGATAGTTGATTTTTATTCCAACAGTATTTATGTTTTGTCATTCTTTTCTA
CATAATCTTGAAACTAGGTAGATCTACAATTGAAAAGTAAATACTAACATTATTTACTAA
ATTTAAGTTAGAAATCGGCACGAAAAAAATTTGACAGATTACGAGAGTCCAGCCAAAATA
TGAGTATATTACTATTTCCCCTTGGTGAAAGAAATGAAAG
Chr coordinates
w3c xhtml validator w3c css validator