Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KSS1
Systematic Name YGR040W
Strain S288c
Description Mitogen-activated protein kinase (MAPK) involved in signal transduction pathways that control filamentous growth and pheromone response; the KSS1 gene is nonfunctional in S288C strains and functional in W303 strains
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>KSS1 YGR040W
ATGGCTAGAACCATAACTTTTGATATCCCTTCCCAATATAAACTCGTAGATTTAATAGGT
GAGGGAGCGTACGGAACAGTATGTTCAGCAATTCATAAGCCTTCCGGCATAAAGGTAGCT
ATCAAGAAAATACAACCGTTTAGCAAAAAATTGTTTGTTACAAGAACTATACGTGAGATC
AAGCTTTTACGGTATTTCCATGAACACGAAAACATAATAAGTATATTGGATAAAGTAAGG
CCAGTATCCATAGACAAACTAAACGCTGTTTATTTAGTCGAAGAGTTGATGGAAACCGAT
TTACAAAAAGTAATTAATAATCAGAATAGCGGGTTTTCCACTTTAAGTGATGACCATGTT
CAATACTTTACATACCAAATCCTCAGAGCCTTAAAGTCTATTCACAGTGCACAAGTTATC
CATAGAGACATAAAGCCATCAAACCTGTTACTAAATTCCAATTGTGATCTCAAAGTCTGC
GATTTTGGACTAGCGAGGTGTTTAGCTAGCAGTAGCGATTCAAGAGAAACATTGGTAGGA
TTCATGACGGAGTACGTCGCAACGCGATGGTACAGGGCACCCGAGATAATGCTAACTTTT
CAAGAGTACACAACTGCGATGGATATATGGTCATGCGGATGCATTTTGGCTGAAATGGTC
TCCGGGAAGCCTTTGTTCCCAGGCAGAGACTATCATCATCAATTATGGCTAATTCTAGAA
GTCTTGGGAACTCCATCTTTCGAAGACTTTAATCAGATCAAATCCAAGAGGGCTAAAGAG
TATATAGCAAACTTACCTATGAGGCCACCCTTGCCATGGGAGACCGTCTGGTCAAAGACC
GATCTGAATCCAGATATGATAGATTTACTAGACAAAATGCTTCAATTCAATCCTGACAAA
AGAATAAGCGCAGCAGAAGCTTTAAGACACCCTTACCTGGCAATGTACCATGACCCAAGT
GATGAGCCGGAATATCCTCCACTTAATTTGGATGATGAATTTTGGAAACTGGATAACAAG
ATAATGCGTCCGGAAGAGGAGGAAGAAGTGCCCATAGAAATGCTCAAAGACATGCTTTAC
GATGAACTAATGAAGACCATGGAATAG
Promoter Sequence
Download FASTA
>KSS1 YGR040W
TTGGGATTCCATTTTTTATAAGGCGATAATATTAGGTATGTAGATATACTAGAAGTTCTC
CTCGAGGATTTAGGAATCCATAAAAGGGAATCTGCAATTCTACACAATTCTATAAATATT
ATTATCATCATTTTATATGTTAATATTCATTGATCCTATTACATTATCAATCCTTGCGTT
TCAGCTTCCACTAATTTAGATGACTATTTTTCATCATTTGCGTCATCTTCTAACACCGTA
TATGATAATATACTAGTAACGTAAATACTAGTTAGTAGATGATAGTTGATTTTTATTCCA
ACAGTATTTATGTTTTGTCATTCTTTTCTACATAATCTTGAAACTAGGTAGATCTACAAT
TGAAAAGTAAATACTAACATTATTTACTAAATTTAAGTTAGAAATCGGCACGAAAAAAAT
TTGACAGATTACGAGAGTCCAGCCAAAATATGAGTATATTACTATTTCCCCTTGGTGAAA
GAAATGAAAGATGTTATTTTTTACCGGCTTAGTAATACTGAGCTACTTACTTGGGGGAAA
GAAAGATTGGCTACTTATTATGTATGAAGCCTCAGATTACCTTGAATTCCTCAACCGTTT
GAGCAGTATGCTCTTCAAATTCGAACTTTTTGAACATCTTTCCTCCACATTCCTGATTTT
TTCACATTCAAAACGCGCTGTGAAGCTGTTAGAAATTTACAGATCGAGGCATATTTCTAT
ATATAATGTATTTTTATTAAGACACCCAAAGTACTTCCAATCTGTAGATATTGCACTTTA
TCTGACCAGAAGCCAGACTTGAACAGTTACATATTGTGCTTTGCAGTCGTTAAATTTCCC
GAACTGTTTTCGTATTTTTTTTTCTTTTCCTCTTTTCCACTGGATCAGATCAAAAGCCGA
CTAAAAATTTGGCAATTTAAAGAAAGCATCTTTTAAAGATAGAAAAGGTTATTTCAACAA
AAAAGTATCTTTTCTTCACTTTTCTTTCAACAATTCAAAG
Chr coordinates Chr VII from 575398-576504
w3c xhtml validator w3c css validator