Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FHN1
Systematic Name YGR131W
Strain S288c
Description Protein of unknown function; induced by ketoconazole; promoter region contains sterol regulatory element motif, which has been identified as a Upc2p-binding site; overexpression complements function of Nce102p in NCE102 deletion strain
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FHN1 YGR131W
TGCAAAAACTGATAAGGGCTTTCCTGCTGATGCGCTTGCTGATTTTGCGTATTTGCCGAA
GATTGATTGATCAATTGCGTAAAGGGGTCGTCTTCTTGACGGTTGATATTGAATAGCATG
TTTTGAATACGTAGTTGATTGACCTCTTTCTTTTAATTGCGTGCAGCTGCTCTCAGGTTT
AAGATGTACGAGGGTCCACGGGGTAGCAAGCACAAGAACGATGATATATATGACAGAACG
ATGGATAAGAATGGTATGTTGTCTGCACTGTTCAGCATTCGACTACCCCTCTCCCGGTTC
TTTTCTCCTCGTTTCAATTTAAAAAAGCAACTCGCTACCCGGCCGCACACCCCTTATTCC
TGTTCAGCCGTTTAAGGTGAGAACCCTTTACTTCATAGCCTTTGTAGATCTTTCTATTGC
TACCATTGAAGGGTCGGTGACGTGGAAATTTTGACATTTATCAGTGGCGTATTGGGAGGC
AAGCAATTGAAAGAACTGTGATTTATTTCCGCTTGTTCGAAATTATTGATGTTTAGCACT
TTGCAGTAGCGACAATACAATATATGTGCTTTTAGTGCTGGGATAGTTCGTAGCTCCATT
TCGGGGCGCTTGTTACATTTATTGTATATGCGCGGATGTGGCACATGCTGTTGAGATCTC
ACTCCTTTGGTATCTCTTTCCTGCGCCGCATTGTGCCGGCAGAATGTCGCGCTTGTATTC
TCATGAACTTTTCCTCTTTACGAACCCTTTGGCGGCATGCCGTTTAAAATCTGTTGAAGA
TTTCCTTTACGAACAATGAGCAATGTTTTGCACAGGCAGGTGGGAAGTAGGGCCTATCGC
GCCTTGGATGCAGATATAAGTATAAATATAAATTATAATAATTGGCTGTATCAGTAAATC
CTTCTTGCGATGGGAGGAAGCACGATAGAGTATGTTAAGCTTTTGAGAGGCTTCATATTC
ATTGGAATTTTAAATAACAATAAAGCAACAACAATAATAA
Chr coordinates Chr VII from 754726-755250
w3c xhtml validator w3c css validator