Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL24B
Systematic Name YGR148C
Alias eL24, L24B, L24e, L30B, rp29, RPL30B, YL21
Strain S288c
Description Ribosomal protein L30 of the large (60S) ribosomal subunit, nearly identical to Rpl24Ap and has similarity to rat L24 ribosomal protein; not essential for translation but may be required for normal translation rate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL24B YGR148C
AAACCGAAATACAGCCATACGTAATTTGGTGGCCTAATATGCCTGGTGTGCTGGATAAGA
TATTATGTTAATGAAATATTTGTACGTACATCCGTTTGTGCGTATGTATATGTGTGTGTA
AAATGTACATTGTCCAAGCTTTCCACAACTCCTATTATCGCTAGTGTTGGCAGGATTATT
TGTTTGAAAATAGCATATATCTCGTTATGTGAAACTTTGCCAAACAATATTCCTTACAAC
ATCCGTGCATACTCTAAACCCAATCACTAATTTTCAATTTTTAAAAACTTTATACTCTGT
ACTGCGGCAATTAAGGCTTTCGCGTCGTTGAGCGCGCAACACTACCGGGGGTTCCTTACC
GTGAGCCTGCGCCTCTGTAGGAGAATGTAGAGGTTCCCGTTGAGGGAACTCCAGCCATGG
GTTGACGGGAGTTCCCGTTTGGCCTGATTGCTCTTGCGCAGTTGACATCTAGCCAGAAAC
AGTAGTAGTGGGAGTTGATATTACCAATATTTACAGGTAACCTATATTGATTAACTAAAT
TATAGGCGTTTAAATTTTTGGGTGGTCAACAAAAGAGGCGAGCAACAATTTGAATTGAAA
CGTATGTCGCGTGCCCATTAGGAAATGAGAGAATATTGAGGACAACGAGGAGCTTCGCAG
TGTAGGAATTGAGAAAGAAGCGACCATTTGAACAATGCTGAGGTTAATAAGAGGCCCACG
ATAAAGGCGTTATATTAATCAACGTTGAACATCTTCCCAGAAAAGTACATGCGAATAAAT
CAGGACCGTCGAAAGACGTACGGAACATCATTGGCAAATATACATCGGGATCTGTTGGAT
ATGCTTGTCGTGATGAAATACTGTTCTCGTTGTCGGCTTGATAAATTTTCTCCCATTTAA
AACTCTTTGAACCAAAATTGTGTACTAACATCAATTTGTATATAAACCATGAGTGTATTT
CACCTTGTGGTTTTTCACAGCTTTTTAATTTAGAAGAACA
Chr coordinates Chr VII from 787779-787312
w3c xhtml validator w3c css validator