Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RTS3
Systematic Name YGR161C
Strain S288c
Description Putative component of the protein phosphatase type 2A complex
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RTS3 YGR161C
TTGCTCTGGAATAAGGTGAACTCTTTAAGTATTTTCTCTTCTAGGCTCAGTTCTCCGAGT
TGTAGGGCAAAATCAACCATGCCACTACTGCCATGATCGCTGCTTGTGCCAGTAGCATCA
CCTATGAAGCCCTGATCGGCTTGAATATTTGCGAAATGTGCATTCGAAGAAAGATGGTTG
AAGTATCCAGACATAATGCTGTATAATGTTGACTATAATCGGTTGTTTTAGCTCTGTGGT
ATACTACAGATGTGCTAAAATATGCCGAAATCACCACAATATACAATAAATACGATATCA
TCATGGACGCATGCACGACATATTACAAGGCGGGGGAAAGAAGAAACGGAGCGCCAGAGC
CACAACGAGGAAGCGGGTTTGTGGCTCTCACATCACAGCCCGCCCCTACCAAGATCGTAA
GCAACGTGTTCAACACGTACCAAAAAACCATAATGGCAAGCCAGCGTTTACCTCACCCGC
GGATGACACATCCTGCTCTTACATATGATCGCGGGCTGTCCACAAAAAACAACCTGGAAA
TACCAAATTTGGCAGCTACCGCGGAGTAGTGGTCATGACGGAGAGAGTTGCCAAAAAGTG
ACTGACTCGACTCCCCTCACAGCCCGGATCAATTTTTCCATGCGTTTCCACGGAAATCCG
AGGTTTGCCGTTAGAGTCCCAAATTGGCGATGGATGATGAGATAATGCGCCCTTATCAAT
CACGCTAAAAATTGCCCCACGCTGTACTCAACGATCATAGCTGGCTATTGTTATCGTTGG
CTTAGATGGTTTCGCCCGTACAAAAATAGACTTGCATATATATAAAGCTTATCTTCGGCC
TCAGTCGTCTAAAAAACTATCTTGCCTAACATTATCTTGTCTTCTTTTCGTTCCCTTGAA
TCATATATAAGAAAAGATAATCAATCATTCGGCTATTTTCTTACAGATACATACATACGT
ATAATTCATCAATCATAGCATTAATAGAAGATAAAGTATA
Chr coordinates Chr VII from 809420-808629
w3c xhtml validator w3c css validator