Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RBG2
Systematic Name YGR173W
Alias GIR1
Strain S288c
Description Protein with a role in translation; forms a complex with Gir2p; has similarity to mammalian developmentally regulated GTP-binding protein
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RBG2 YGR173W
AATTACCATGAGGGCAAAAACACTGTAGAAAATCAACAGTGGGTAGGCAATTAGCAATCT
TGCATTTTGCAATTGGAGCAAAGAATTTAAAAATCCAGACGAGGTCCAAGTACTCCAAAT
TACAAATAGTACTGATACAACATAACCTGTAGTGTTGTTCAAACCATGGAAAATGCCCAG
TAAAGAAAGGAAACACAGAGGCAAAAAGCAGTATCCTAAGATGGACGCTGTATTGAAAAA
TTGTAGGTTCGTTTGAGTGGAAGTATCGTTATTGCTCATTAATTTCGATAGATTGTGCAA
AGAAATGGTACCAAACAAAGCGACACCATAGATATATCCAAAATGAACCTTTCCAGCCAT
CAATAGAAAAAGTCCGAATAACAAAAAGAATATCAAAGGCCCAGCCAAATCTGAATCGTT
TAGAATTTCTTGTGGCACACCACTACCAAAACGTATTGGTATAAGAACCATTTTAGTTTT
CGTTATGATATGATCGAAATTTATTCCAATTTCCTCCAGTAATGGAGGTTCATGTGGATA
TCCCTTAGTTGAAAGAGCATGTAAAATACCTACAGGCAAAGGGTCGGGGGCAACACCCAA
ATTGTTATCGTTGCCAGTATTAGAAGAACCGACGGTATTTTGAAAACTCATTGACCCTTG
GGGAACGGCAAATTGTGCAGAAGGCTGATAAAAGCCACCGCCATTATTAGCATTGTTACT
AGTATTGTAGAAAGACATCTCGAGAGGGACTAATAGTTGTCTTGCAGTACTTCCCGTCCA
ATTTGTAGCTGTTATAAGATGACTTGGTTCGTGTCACGTAGTTACCTCACTCAAATAGCA
AAATAATCAATGGTTACCCGAAGTGAAAATTTTCGTGATAATAGCGATGAGATTTAAACC
CAGTTATAAAAGTCGTACAATATTGAAGCTGTTGATATTGGAATTGAACAAGTACTAACG
AGATACGCATTATCAAAACTAACGTAACAAGCACTACAAA
Chr coordinates Chr VII from 843854-844960
w3c xhtml validator w3c css validator