Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATF2
Systematic Name YGR177C
Strain S288c
Description Alcohol acetyltransferase, may play a role in steroid detoxification; forms volatile esters during fermentation, which is important for brewing and winemaking
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATF2 YGR177C
CCGATGGGAGGTCCATCGGCATCACCAAATCCGATGATGAATGGCTTTGCTGCTGGGTCA
ATGGGTATGTACATGCCATTTCAACCTCAGCCAATGTTTTATCACCCATCTATGCCTCAA
ATGATGCCAGTTATGGGTAGCAATGGGGCTGAAGAAGGAGGAGGAAATATTTCGCCCCAT
GTCCCTGCAGGTTTTATGGCAGCTGGCCCTGGCGCTCCTATGGGTGCCTTCGGGTATCCA
GGAGGGATACCCTTCCAAGGAATGATGGGATCAGGTCCATCTGGCATGCCAGCGAACGGG
TCGGCAATGCACAGTCATGGCCATAGTAGAAATTACCATCAAACTAGCCACCATGGCCAC
CATAATAGTAGTACCAGTGGCCATAAATAGTGAAGGAAGCACGTCAGAAAAAGCAATATA
TAGTAATAAATTCATGCACTTTATAAATATGGTATATAATCAGTGGTACTTACTTACCCA
TAAATAATGGAACTTTTAATTTTTATGGGAAGGATACTGGATTTTCATTTTTTTCATTTT
TTTTGGAACAGGGTACTGAAACTTTTCTTTTTGAAAAAAAAATAAGAACTGAAGAATTTC
AATGAACTGGAAGGCTCATCCATTTTTTTTTTTTTTCTTCAGATAGAACAGGCTTTAGCA
AATTTTAAGTAATCAGTATTTCAATCGCCACAATCTCAGGCTACATTGAACTCTGTAGGC
CACCGATAAATATTGCGGGATAATGAGTAAACGAATTCAACGAGTTTCCTATTTTGGTAT
TCTATATTTTTTCATACACCTAAACGATCGTAAACATTTGTTGTCAAGATTTACGTTTCT
TCGAGGTCTGTGAAAATAGAGCAAATTGTTACTTAAAAGACAACAACAAATGTGTAGGGC
AATTCTGCAGTAACAGCAATGTCATTCCTAATGCGTACAAACAGTACTGAGACTTTCAAA
CGAATAATAACTTCAGCAATAAAAATTGTCCAGGTTAATT
Chr coordinates Chr VII from 850436-848829
w3c xhtml validator w3c css validator