Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATF2
Systematic Name YGR177C
Strain S288c
Description Alcohol acetyltransferase, may play a role in steroid detoxification; forms volatile esters during fermentation, which is important for brewing and winemaking
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ATF2 YGR177C
ATGGAAGATATAGAAGGATACGAACCACATATCACTCAAGAGTTGATAGACCGTGGCCAT
GCAAGACGTATGGGCCACTTGGAAAACTACTTTGCTGTTTTGAGTAGGCAGAAAATGTAC
TCGAATTTTACTGTTTACGCGGAATTGAATAAAGGTGTTAATAAGAGACAACTAATGCTT
GTCTTGAAAGTATTACTTCAAAAATACTCAACTCTTGCGCATACAATCATTCCTAAGCAT
TATCCTCATCATGAAGCGTACTACTCTAGCGAAGAGTACCTTAGTAAACCTTTTCCACAG
CATGATTTCATAAAGGTGATTTCTCATCTTGAATTCGATGACTTGATTATGAATAATCAA
CCAGAATACAGAGAAGTCATGGAGAAAATCTCAGAACAGTTCAAAAAGGATGATTTCAAA
GTCACCAATAGGTTAATCGAATTGATTAGCCCTGTAATCATACCTCTGGGTAATCCGAAG
AGGCCTAATTGGAGATTGATTTGTTTACCAGGTAAGGATACTGATGGGTTTGAAACGTGG
AAAAACTTCGTTTATGTCACTAACCACTGCGGCTCCGACGGTGTCAGTGGATCGAATTTT
TTCAAAGATTTAGCTCTACTCTTTTGTAAAATCGAAGAAAAAGGGTTTGATTATGATGAA
GAGTTCATCGAAGATCAAGTCATCATTGACTATGATCGAGACTACACTGAAATTTCTAAA
TTGCCAAAACCGATTACGGATCGTATTGACTACAAGCCAGCATTGACTTCATTACCCAAA
TTCTTTTTAACAACCTTCATTTATGAACATTGTAATTTTAAAACCTCCAGCGAATCTACA
CTTACAGCTAGATATAGCCCCTCTAGTAATGCTAATGCTAGTTACAATTACTTGTTGCAT
TTCAGTACTAAGCAAGTAGAACAAATCAGAGCTCAGATCAAGAAAAATGTTCACGATGGG
TGCACCCTAACACCCTTCATTCAAGCGTGCTTTCTTGTAGCCCTGTATAGACTGGATAAG
CTGTTCACAAAATCTCTTCTCGAGTATGGGTTCGATGTGGCTATTCCAAGCAACGCAAGA
AGGTTTTTACCAAACGATGAAGAGTTAAGAGATTCTTATAAATACGGCTCCAACGTTGGA
GGTTCGCATTACGCCTATCTAATCTCCTCATTCGACATTCCCGAAGGTGACAATGACAAG
TTTTGGAGTCTTGTCGAATACTACTATGACCGCTTTTTAGAATCGTACGACAACGGTGAC
CACTTGATTGGTCTGGGGGTCCTACAACTTGATTTTATCGTTGAAAACAAGAATATAGAC
AGCCTTCTTGCCAACTCTTATTTGCACCAGCAAAGAGGCGGTGCAATCATCAGTAATACA
GGACTTGTCTCGCAAGATACGACCAAGCCGTACTACGTTCGGGATTTAATCTTCTCGCAG
TCTGCAGGCGCCTTGAGATTTGCGTTCGGCCTAAACGTTTGCTCCACAAACGTGAATGGT
ATGAACATGGACATGAGCGTGGTTCAGGGCACTCTACGGGATCGTGGCGAATGGGAATCG
TTCTGCAAGCTCTTCTACCAAACCATCGGCGAATTTGCGTCGCTTTAA
Promoter Sequence
Download FASTA
>ATF2 YGR177C
CCGATGGGAGGTCCATCGGCATCACCAAATCCGATGATGAATGGCTTTGCTGCTGGGTCA
ATGGGTATGTACATGCCATTTCAACCTCAGCCAATGTTTTATCACCCATCTATGCCTCAA
ATGATGCCAGTTATGGGTAGCAATGGGGCTGAAGAAGGAGGAGGAAATATTTCGCCCCAT
GTCCCTGCAGGTTTTATGGCAGCTGGCCCTGGCGCTCCTATGGGTGCCTTCGGGTATCCA
GGAGGGATACCCTTCCAAGGAATGATGGGATCAGGTCCATCTGGCATGCCAGCGAACGGG
TCGGCAATGCACAGTCATGGCCATAGTAGAAATTACCATCAAACTAGCCACCATGGCCAC
CATAATAGTAGTACCAGTGGCCATAAATAGTGAAGGAAGCACGTCAGAAAAAGCAATATA
TAGTAATAAATTCATGCACTTTATAAATATGGTATATAATCAGTGGTACTTACTTACCCA
TAAATAATGGAACTTTTAATTTTTATGGGAAGGATACTGGATTTTCATTTTTTTCATTTT
TTTTGGAACAGGGTACTGAAACTTTTCTTTTTGAAAAAAAAATAAGAACTGAAGAATTTC
AATGAACTGGAAGGCTCATCCATTTTTTTTTTTTTTCTTCAGATAGAACAGGCTTTAGCA
AATTTTAAGTAATCAGTATTTCAATCGCCACAATCTCAGGCTACATTGAACTCTGTAGGC
CACCGATAAATATTGCGGGATAATGAGTAAACGAATTCAACGAGTTTCCTATTTTGGTAT
TCTATATTTTTTCATACACCTAAACGATCGTAAACATTTGTTGTCAAGATTTACGTTTCT
TCGAGGTCTGTGAAAATAGAGCAAATTGTTACTTAAAAGACAACAACAAATGTGTAGGGC
AATTCTGCAGTAACAGCAATGTCATTCCTAATGCGTACAAACAGTACTGAGACTTTCAAA
CGAATAATAACTTCAGCAATAAAAATTGTCCAGGTTAATT
Chr coordinates Chr VII from 850436-848829
w3c xhtml validator w3c css validator