Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCH1
Systematic Name YGR203W
Strain S288c
Description Phosphatase with sequence similarity to Cdc25p, Arr2p and Mih1p; member of the single-domain rhodanese homology superfamily; green fluorescent protein (GFP)-fusion protein localizes to both the cytoplasm and the nucleus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCH1 YGR203W
TCGTCAACCCATCTGCAGTGCGTTAAAGTTTCACAACGCTGCTTATCGGTCAGCACAGTC
AAACCTTTTAGTTTGTGAGTGATTTTGTCGCTAGGCACACCAACTATCAGTGTTACATTG
GGGAAAGCCTTCTTACACTGTTCCAGTTGCTTCATGTGGCCAAGATGGAAAAGATCAAAA
ACACCATCTGCATATATCCTGATGGGTCTATCCGTTGGAGGCAAATTGAATCTGAAACCT
TTAGGACGATACTTGCGCAGTTCCTTGGGCAACTCGTTGGTGTAACGAGCCTCCTTCTCT
TCAAACTCCTTCGTCAACCGGCGACGCTTGCGGGGAGTGAGCTGTGTGTCCTTATTTTCA
TCCTGGTTCTTACTCTCATCCTTATCCTCATTGTCCTGCTCTTCCGTTTCCTCACGCTGT
CTTTTATTTTTATTTTTTTTAAATAGGTTTGATAGCGATGAGTTAGAAAGCTTAGCCCTA
ATCGAGGACTTCCCTGTTGTTGGGTTTGCCATTTTTCTTTGTGTCTGCTGTGCTTTGTAC
TACCAAGAGAGAATAGCAAGAGTGAAATTTGAAAGTTAAACAATACAATAAAGAAAAGTG
ACTGGCGTATGCAAGAAAGGGGAATGGGTATAAAAAATACAAGAACGGCAGAAAAAATAA
AAGAAACAGGAGAAACAAACAATGGTAACTGTACTAAAACCAATACCAGATATATATTTC
ATACTTATTAAAAAGCGTTAAGAAACGAAGCGTAAAAACGTAAGAAAAAGAATGACTATA
TAACGGTAGGTCTTCGACTCATTTTTTTCTTCCTACATGCAAACGACAAATACGGGTAAT
GCACATTTCGCTTATTGGGTTCTTCCCTTTCCTTTTTTCCATTTTTTTCTTTCTGGCTGT
CGCTAGCCTTTCTACTTCCTCCGCACATACAGTTTTCAGCACAGTATAGATAGCTGTGCA
GCCAGATAGAAGCAAAAGAGAAGTCAATTGCAAAAAAAAT
Chr coordinates Chr VII from 905237-905683
w3c xhtml validator w3c css validator