Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADE3
Systematic Name YGR204W
Strain S288c
Description Cytoplasmic trifunctional enzyme C1-tetrahydrofolate synthase, involved in single carbon metabolism and required for biosynthesis of purines, thymidylate, methionine, and histidine; null mutation causes auxotrophy for adenine and histidine
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADE3 YGR204W
AACCAATACCAGATATATATTTCATACTTATTAAAAAGCGTTAAGAAACGAAGCGTAAAA
ACGTAAGAAAAAGAATGACTATATAACGGTAGGTCTTCGACTCATTTTTTTCTTCCTACA
TGCAAACGACAAATACGGGTAATGCACATTTCGCTTATTGGGTTCTTCCCTTTCCTTTTT
TCCATTTTTTTCTTTCTGGCTGTCGCTAGCCTTTCTACTTCCTCCGCACATACAGTTTTC
AGCACAGTATAGATAGCTGTGCAGCCAGATAGAAGCAAAAGAGAAGTCAATTGCAAAAAA
AATATGGACTCGTACTCAATAACAAACGTAAAATACCTGGATCCGACTGAATTGCATCGT
TGGATGCAAGAAGGACACACTACTACGCTGAGGGAGCCTTTCCAGGTAGTGGATGTGCGA
GGCTCAGATTATATGGGGGGCCATATCAAGGACGGATGGCACTACGCCTATTCGCGCCTT
AAGCAGGATCCGGAGTACTTACGTGAGCTAAAGCACAGATTGTTGGAAAAGCAAGCGGAC
GGCCGCGGAGCGCTGAACGTGATTTTCCATTGTATGTTATCGCAGCAGCGCGGACCGTCT
GCAGCGATGCTGCTGCTTCGGTCGCTTGACACGGCGGAACTTTCTCGCTGTCGTCTATGG
GTGTTGCGTGGGGGGTTCTCGCGCTGGCAATCCGTATACGGTGACGACGAGAGCGTTACG
GCGGGTTACCTACCCGATCTGTGGCGTTGACAGGTTTACACAATCGCACGTGATCATATA
TTTGCCATGACTCCTCCCAGTGACAATTTTGTTCTTTTTTCCTCTTTATCGCTTTCGTAC
TATGGTCAGTCATTCATTCATTATATACGCGCTCTCCATAACCCGTAACTTTTTATTATA
TATAGACTCGTTTACAATACAACGATAGCGATACCATTCAATTGAAGTTGTGAGACCAGG
TAACGAGACGAACACAACTTTACAAGTCAAATAAGAAATC
Chr coordinates Chr VII from 905934-908774
w3c xhtml validator w3c css validator