Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SER2
Systematic Name YGR208W
Strain S288c
Description Phosphoserine phosphatase of the phosphoglycerate pathway, involved in serine and glycine biosynthesis, expression is regulated by the available nitrogen source
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SER2 YGR208W
TCCACAGAATTCAATTTCACACCAGGTGACTTAGTCTTTGGCTCTTCCATCGACACTATC
TTTAACTGAGGTTCAATATTAATTTCAGGAAAATCTTTTGCTATATCCAATTTTTCAATA
GGCTTTTTCTTCGCCTTCATTAGTTTGGGCAGTCCTACGTAACGCGGAGTGTTCAATCTC
AAATCTGTAGTAATAACCATTGGTAAGGAAGCTTCAATTACTTCTTCTCCATCGTCAATT
TCTCTTGTTACCTGAACTCTACCATTATCAAGGAATTCCACCTTTGCCGCATTTGTTGCC
TGTGGCCAATTTAATAAACCTGCCAACATCTGACCGGTGTTGTTACAGTCATCATCAATG
GCTTGCTTTCCCATCAAAACCAGATTAGAACCCTTCTTTTCAACAACAGCTTTTAAGATT
TTAGCAATTGCTAAGGGCTCTATGTTTTCTTTACCCACAGAGTCAATTAAACTACAGGTG
TCTATTCCCTTAGCAAGGCAATTTCTTAGAATATCCTGAGCTTTGGCGGAGCCAATAGAA
ACTGCATGCGTAGATTCTACTAAACTCTTGTTCTTTTCTTTAATTCTGATGGCTTCTTCG
ACAGCAATATCATCGAAAGGGTTGATACTGAATTTGATTCCACTGGTTTCAATCCCAGTT
AAGGTCTTATTTACTCTAGGCTTGATCTGGAAATCAACTACCCTTTTCACCGGAACTAAT
ATACGTAGTTGCTGTTTTGCAGACATTTTTATTACTCTTTCTGATACTTGATTATCGGGG
TTATTGATCCTAGTGTGTCTTGACAACGTTTCTCGAATCAGGATTATTTTACACCGAGAA
AGAAAGAGTCAATACTAATAATCTCGAAAGATCTTCAAGTGAAAAATAAAAAAAAATGAT
AAATAAAAAATAGAAACTATGAAACTATGTAAAAAAAAAACAAATAGACATATCCAAGCA
AGTCCAATAGCATAGACATTAAGCACGACAGCTGTAAAAA
Chr coordinates Chr VII from 911883-912812
w3c xhtml validator w3c css validator