Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGR210C
Systematic Name YGR210C
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGR210C YGR210C
TTTTCTCATTTCCTGGTCTTGCGACAGATCGTCGATCATCTCGGATAACAAACCTTCAAC
TGTCGTCAATTGACCTCTCTTAGCAGGAATCTCAATGTCTAGCTCGACAAACTTACAAGT
GGCAGTTTCTGACTTAATAACTTGCCTGTTAAAATCTTCACGGCACTCCACTTTCAAAAC
GTAACGAGAGCCCTTCTCTTGAATTTGAGAAGCGGGTTGGATCTCACAGTTCTTAAACCC
ACAGTGAGGACAGTCGAATGACATAATAATTATTTCTCTGAAATAAGGGATGGAAGTCAG
AAGAAGTCTGGTTGTACCGTTCTTTCCACAATTCATACAAAGAGACTCTATCTCTTGCAC
TGGATGGCCCATGGCGTCCTGTGCGCCGGTTAACTTGACGCCGTCATTAGCTTTGTTCTG
TTCGGCTATGCTTTCATCTTCGACCTCTGCAGCAGCTTCTCCTACTGGTTTAAACAAATC
TTCCTTTTGTTCGCTCATTATTTTCTATCCTATTTCTTAACGGTATAGGTATAATATGTA
TCTCTGTGTATATATGCGACTAGCTATTGCTAACGATGCGAACCTACCCGATAACGCTAT
GATTTCCTTTGCGTTGAACATCATAGCATTATAAATGTGCATCTCATCGCTGAAAAATTT
TCGTCAACTATAAACTTTTAGGATATTCTAGCCCTGATGGGGCTAGAATATTCTAGAAAA
CTCCAGAGGGTTTCGGCACAATTTATTGTAGGGTTAGTAAGGGCTTTTTTATCAAGGTGA
AAAATTCACTCGATGCCTTTTTTTTTTTTTCTCGAATAGATAGATATGCAAGAAATGTAA
TGCTATGCAGTGCAAAACAGATGTGTAAGTGTTCTAGGATGAATTGTAATGAGAGTTGGT
TTTATTTTCATTTTGCGTTTTCGTTTTCCGTCTTTTAGCTTTTGTCCAACTAACTTGTAG
TATAAGCTGTCTGTAAGAATAAAACGGAAATAGAGCCAGT
Chr coordinates Chr VII from 914738-913503
w3c xhtml validator w3c css validator