Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ZPR1
Systematic Name YGR211W
Strain S288c
Description Essential protein with two zinc fingers; present in nucleus of growing cells, relocates to cytoplasm in starved cells via a process mediated by Cpr1p; binds translation elongation factor eEF-1 (Tef1p); relative distribution to nucleus increases upon DNA replication stress; human ZPR1 gene can complement yeast by allowing growth during down-regulation of yeast zpr1
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ZPR1 YGR211W
CGTTGCTGTATGTTTACGCACAATAGACCCCCATCTTTTCTTCAGGTTCCCCTCAACCCA
AAGCCTGATTTCGTCTTGCAGCCATTCTATATCGTTCAATGGATCATATCCTCTTGTGTT
CTTCCCCTCTGCATCTGTGGTTCCACTAACGTCCACCACATGAATAAGAGCATCTGCGTG
TCTTAAATCATCCAAGAATTTATTTCCAAGCCCTCTGCCGGAATGCGCTCCAGGCACAAG
CCCTGCCACATCCAACAGTTTGATGGGGATATGCCTCTTACCCTTGCTACACCACCCGTA
GTTAGGTTTACAAAGATCTTCCTTGCCAAATCTGGAGCAAGCACACTCAACTTGCAAGTA
GCCGGTTGCCTGATTTGGCTCGATCGTGGTAAAGGGAAATGCTCCTACCGCCGCACCTGC
GTCCGTCAAAGAATTTAATGTGGTGGATTTCCCTGAAGATGGCTTACCCACAATACCAAT
CAATGGATCCCTGGGCATACTGGCTCTATTTCCGTTTTATTCTTACAGACAGCTTATACT
ACAAGTTAGTTGGACAAAAGCTAAAAGACGGAAAACGAAAACGCAAAATGAAAATAAAAC
CAACTCTCATTACAATTCATCCTAGAACACTTACACATCTGTTTTGCACTGCATAGCATT
ACATTTCTTGCATATCTATCTATTCGAGAAAAAAAAAAAAAGGCATCGAGTGAATTTTTC
ACCTTGATAAAAAAGCCCTTACTAACCCTACAATAAATTGTGCCGAAACCCTCTGGAGTT
TTCTAGAATATTCTAGCCCCATCAGGGCTAGAATATCCTAAAAGTTTATAGTTGACGAAA
ATTTTTCAGCGATGAGATGCACATTTATAATGCTATGATGTTCAACGCAAAGGAAATCAT
AGCGTTATCGGGTAGGTTCGCATCGTTAGCAATAGCTAGTCGCATATATACACAGAGATA
CATATTATACCTATACCGTTAAGAAATAGGATAGAAAATA
Chr coordinates Chr VII from 915241-916701
w3c xhtml validator w3c css validator