Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ZPR1
Systematic Name YGR211W
Strain S288c
Description Essential protein with two zinc fingers, present in the nucleus of growing cells but relocates to the cytoplasm in starved cells via a process mediated by Cpr1p; binds to translation elongation factor eEF-1 (Tef1p)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ZPR1 YGR211W
CGTTGCTGTATGTTTACGCACAATAGACCCCCATCTTTTCTTCAGGTTCCCCTCAACCCA
AAGCCTGATTTCGTCTTGCAGCCATTCTATATCGTTCAATGGATCATATCCTCTTGTGTT
CTTCCCCTCTGCATCTGTGGTTCCACTAACGTCCACCACATGAATAAGAGCATCTGCGTG
TCTTAAATCATCCAAGAATTTATTTCCAAGCCCTCTGCCGGAATGCGCTCCAGGCACAAG
CCCTGCCACATCCAACAGTTTGATGGGGATATGCCTCTTACCCTTGCTACACCACCCGTA
GTTAGGTTTACAAAGATCTTCCTTGCCAAATCTGGAGCAAGCACACTCAACTTGCAAGTA
GCCGGTTGCCTGATTTGGCTCGATCGTGGTAAAGGGAAATGCTCCTACCGCCGCACCTGC
GTCCGTCAAAGAATTTAATGTGGTGGATTTCCCTGAAGATGGCTTACCCACAATACCAAT
CAATGGATCCCTGGGCATACTGGCTCTATTTCCGTTTTATTCTTACAGACAGCTTATACT
ACAAGTTAGTTGGACAAAAGCTAAAAGACGGAAAACGAAAACGCAAAATGAAAATAAAAC
CAACTCTCATTACAATTCATCCTAGAACACTTACACATCTGTTTTGCACTGCATAGCATT
ACATTTCTTGCATATCTATCTATTCGAGAAAAAAAAAAAAAGGCATCGAGTGAATTTTTC
ACCTTGATAAAAAAGCCCTTACTAACCCTACAATAAATTGTGCCGAAACCCTCTGGAGTT
TTCTAGAATATTCTAGCCCCATCAGGGCTAGAATATCCTAAAAGTTTATAGTTGACGAAA
ATTTTTCAGCGATGAGATGCACATTTATAATGCTATGATGTTCAACGCAAAGGAAATCAT
AGCGTTATCGGGTAGGTTCGCATCGTTAGCAATAGCTAGTCGCATATATACACAGAGATA
CATATTATACCTATACCGTTAAGAAATAGGATAGAAAATA
Chr coordinates Chr VII from 915241-916701
w3c xhtml validator w3c css validator