Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RTA1
Systematic Name YGR213C
Strain S288c
Description Protein involved in 7-aminocholesterol resistance; has seven potential membrane-spanning regions; expression is induced under both low-heme and low-oxygen conditions; member of the fungal lipid-translocating exporter (LTE) family of protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RTA1 YGR213C
TACGGGATCTGGCAAGTGTCCTGCCCTGCTACTATCTGCCCGGCAGCAGGCCACTGTACT
ACTCACAATTGGGAACACGACGGGATTCTGGTATCCATGGTAGGGTGCGCAGGATTGTAA
CGATGGCCCTGCACATTTACAATCGTTGGCTGAGATGAGCCTGTTCCAGCCTACGAAGTA
AATTCCTCCATCCCTCCAGGCAGGATCTGTCCCAATTCCTTCCTGCCTGGAGAATCTCTG
GGCCTGCGTTTCTCACTTGAGGTGCGCTCATTGGACTTTGCGCTACTACCAATGCGAAGA
ATTCGAGCTTTTAACGTGGCGCGCTCAGCGGCATAATACTTTTTTTTTCAAAGTTTTTTT
CTTTATGTCTGGGTTTTTTAATATGTTTGGGTTTTTATCATATTTCAATTTTAACCGGAC
TTTTTGCTTCTATTCTTGTGAAGCGCATCCAAAAGCGGAAATATCTATCATTCAAAAAGA
AAGTTTATTTTTAAGTTTAAACTTTACAAGCCACAATAAGGTATATAGGTCGTTTTGTTT
TCAGACATGCATCATTGACTATTTCCTATGAATTTTGATGAATATTACTAAGATAAAAAA
ACACTGTAAATTGCTCATCAACTGTTTTCCTCTACAAACAAATCTACACTTGGCTGGCAT
GGGTGAATCGTTTAGCGTGTTCTTTTTTTTTTCGCGGCTTCTTTAGATTGCGCCTGTTAG
TAAGATGCCCGCTGTCAACAATCTGCTCAATGCGGTATTCACAATGATATCTGTGATATT
TCAAGCCTCACTTGCTAAAGATGAGTTCCGTGGATCTTTGGTGAAAAGAACAATAAGAGG
TTGTCATATTCTTGGGAAGGGGCTTATCATGCAGCAAAAGACTTATGCGTATATATAGTT
TTCATAATAAAGGGATAAGATACCTTGCCTGTTTCATTCTATAATAATAAACCCTGTAAA
AGTATGTAATAGACAGTCAGCACTTTTCACCACTTCGAAC
Chr coordinates Chr VII from 919465-918512
w3c xhtml validator w3c css validator