Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CCH1
Systematic Name YGR217W
Strain S288c
Description Voltage-gated high-affinity calcium channel involved in calcium influx in response to some environmental stresses as well as exposure to mating pheromones; interacts and co-localizes with Mid1p, suggesting Cch1p and Mid1p function together
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CCH1 YGR217W
TCTTTTTCCACCATAGAGCCAACATTCTGTATGTTATCCTTCTTATTAATACGCTCATAC
TGTACTGGGAAATAGCAAATTTGTTGACAACGAAGATCGATTTGCTGGACAAATGCCGAG
TAATTTACCAACTGAAAGTGCGAATAATTTAATAACGAGGATACGAGACTAGCAATAGAG
CAGATCACAAAAGTCAAATAAAAACCAATTTTTGCGACCATTTTATAAATACAAGTAGAT
GAACACCAAGCTGCGACACTATTAAGCATAGTACCCCTCAAATTTTCCTGTGATGTTTGA
ATAAACGGGTAAAGCTCATTTAATGCTTTACAATATGCGGGGAATAGATTAATGATGTTC
AAAGTTTCACTCAATTTCTTATTATCTCTCTTGTATCTTGGATGTTGCTCTAATTTAGAA
TAGTTCAGAGTTTCACCCACACTACTATGAAGACCAACTTCTTTTTCTGGTATGATGAGC
GAGATGGGATCAGAAGAATAGAATTGCATAAATTTCAGCTTGGGTATTCTAAAATGGACA
TTACAGGGATCAGCAACTTTGTAGTTCCAACCCTCCGCTCCATTGTTCTTAGTAGCTACC
ACTGAATAAGGGGGCCGTATGCTTACTTCTTCTAAATACTGAGGTTCGCAAACACCTAAG
ACAACAAAATGCGTCTTCTCAAATGAAATTGCCAAAGCTACCTGAGGTCCTTGAGCTGCG
GAATTCTCGAACAAGGATTCGTATGGCCAGAAAATGTAATTTGGCATGTCATTTAACTGT
ATAAAACCGCCCCTGAATTCGAAGGTTCCTGTTCACAGAGGAATTTTCATTCTTTTTGGT
ATTATGTTCTGGTAGGTTTTTTTCATATTCTACATTTCGGCATTCTCACTGAAAATAAAT
ATAGATGAGATAGAAGATCATGAATCAATGGTTGGTGACAAGCTAACATAAGGAAAATCA
AAATACACGGCATTACTAAATAGAATATATTGTTAGTACT
Chr coordinates Chr VII from 924696-930815
w3c xhtml validator w3c css validator