Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AZR1
Systematic Name YGR224W
Strain S288c
Description Plasma membrane transporter of the major facilitator superfamily, involved in resistance to azole drugs such as ketoconazole and fluconazole
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AZR1 YGR224W
AAGATCTCTATTGTGTTCTCCAGGACTACCACAATATGAATCCTAGATAAAAACACGTCT
TTAATGGAAGACATAAACTTCAAAGTAATCGTTTCCTTTTGCAAAAGATCATCCCAGATG
ATCAGTTTATTTAGAGCATGCCTTGGTCGTTTACCACCTCCGACTAGTGCGATGTAATTC
GTACGATAAAGCATCCTGGTATAGCCAATCCCAGTGCCCCTGGATTGGTTGGTCGCAGAC
TCTTTAAATGTTTTCGATAGCTTACTAGTCAATGGATCTGTATTGAAAATACGAAATCCA
TTCTCTAACGCCACGCTGAAACACGAATCATCTTGGTTAAACGAAACGCTCAAAAATTTT
GGTTTCCTCCTGTTGTTGACTGCCTCCCTTATAGGTCGACGAACATCCATCTGCTAGTTA
TGTATGCTTATAGTTGTCCTCTAATAATCGCTGCCTTTCCAGATCTTCTGGTTTCTCTTC
CCTTTAACAATAGCCCCCGCAGTACGTATTACTAAGGTAAATAAATATAACCGGCTTTAC
AAGCCAGAAAGCCGTGATCACGTGATTATCAATTTCTTTATTTCATTTCGCTCAGATACT
GCCAAAAGCCCCTGATCTTGAACACAAAGGTAAACAACGTTAATATGAACCTGGCTATCA
TCATTAGGATAGGCTCATTTTCTCTTTTTAACTCAGGCCCCTTTCTTGCACTGTTACCAT
AGGATCTTACCAATTTGCATTATTTCCGCCAACTAGCGGATATCCGCTGTATTTCCGCGC
TTCTATATGCTATGGCTGGAAATACAATAAAAAGTGTCAAGCAGAACCACTACATTAATT
TAAAGAAAAATGTCTTATATCAAAGAATCGGCACTGTATCAATTGATTATATATAATGCT
AGAGTTTCCGTACCCTCTTGCAACGTCCTTTAAATCTTGTATCTTTTCTTCTACAATTGT
AGTAACACCACGTCTACATTAGTATCTAAATTGCAGCCCA
Chr coordinates Chr VII from 942806-944647
w3c xhtml validator w3c css validator