Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SOL4
Systematic Name YGR248W
Strain S288c
Description 6-phosphogluconolactonase with similarity to Sol3p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SOL4 YGR248W
ATAGCATTATGGTATTGTCCACCACAAGGATCAGTTGCTTACGAGACATTACAGATGCTT
ATATTTTCGTTTCAAACGTTGTTCCCAGATTCACCAGTTTTTGAACCTCATGTGACGGTA
ACGTCCCATTTGGTGTGCAATAGTAAAGATGATGTCAACAAAATCTTGACCTCCTGTGTT
GCTGCCATCCAATCGATAAGGTCACACCAAACAGCAAAGAAAGGACGTAAGGGACAGGTA
TCCCATGCTGTTGCAGCTCCTTTGGTATCTTTCAATGGATGCAGTGTAGGTAAACAATAT
TTCAAGAAAATTGTGCTCGAGTGTAACAAGAACAAAATACTTTATGGGGTCGCACAAGTC
ATGAGAGAGATGTACGTAGAGATCGATCCTGAGACGCGAAGTAGCCGTGCCGCCACTTGG
GTGCACGAGGAATTCCATCCTCACGTCTCATTGCTTTATTCGGATATTCATCCGGTAAGT
CAGGCGTCATTGCGAGTAGTTCAACAAAGAATTGAAGATGCTCTAGACGTGCAACTAGTT
CCAAGAGAGAAACGTAAGGGTTCCGGAAACGCTGATGGGTCCAATGAAGTGCAAATGAGA
TGGGATTTTGACGTATCTTCATCGCTATCTTGGAATATCCCAGGAACGTTTAAAGTGGTC
AACTGTGTGGGGCCCGTTCAAGAATGGGAGGTATTGGGACGGGTGGACGTTTAAGCATAC
ATTTATGTGCACTGTAAGTAATTATATAGAATTTTTTTTTTTTTTTTTTTTTTCATATCT
GTCAATACTTGAAAATGTTCTAGTTAGAGATTTACGTATACTGATCGCTTGCCTTCGCAA
GGGATGGAAATCCCTTGAAAATTAAAAAAATCCCCCCCTAAGCAGCGAAAATTGTAAGAT
CCATAATATTTAAGAAATGACGAAGAACGTAGTCTTATCGCAGCAGTTTTCCAAACAAAG
AATGCCATTCATCAAATAATCCACAACCACCTCAAGAAAA
Chr coordinates Chr VII from 985972-986739
w3c xhtml validator w3c css validator