Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MGA1
Systematic Name YGR249W
Strain S288c
Description Protein similar to heat shock transcription factor; multicopy suppressor of pseudohyphal growth defects of ammonium permease mutants
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MGA1 YGR249W
CTGCAAAACAGCGCTAACGGAAATTTCCATGGAAATAGAATAAGGGACGCAGCAGGGTTT
TTTTTTTTGGCGAGCACACGAAATATAAAATTGCTTCGGGCCAGCTGCATGGAAGGGTTA
ATTTCGCCCCTTTATCGCAAGCTACGCAGTTCTCCTGGCTCGAGAATGAATCTGGCCCGC
CGCAGACGTTTCCTGGCCCCAGATTAGGAAGCAGCGGCGGCGGAACGGAAGGTGCTCTAA
GCAAAATAAGGAATATTAGCCACGCCGGTAATTCCCCTCCTTTGGTCTGCCCCTGGTCTG
CCCCTTTCGTTTTTTATTTTTTTTTGGGTGAACGGAATACTCCGTGGGCGGCACAAGGAG
AGCCTGCGTAGGAATCTGTGCGTCTCAGTCGGGCGGGCCGATTTAGCACCGATGGTTCGC
TTTGGCTTGGGCTTACGGTGACTGCGAGATTTGCAGATTAGTGCATATCCGCGCCTTTGT
ATGACGTGAAGCGATCCGCCCTGAACAACTTGTTACGTATATGATGTTGACTCTGCGCCC
CCGTCTCTCTGGTTGCTGCCTTCTGCGCTGATTTGGTGCAATCTTTCTTTTTTGTCTTTG
AAAGATTTAAGCTTTTTTTCGAGAAGAAAAAGGAGGAACCGAAAAAATAATCTTTCAGTT
GTTGACCCGTAGAGCAGAAAATGGAAGGCAGTAGATATCCATATCGAAGGAAAAGCACAA
ACTTATCACGTTTAGGGTATTCATTAACGTTGAAGTAATCAGGTAGTGAATAGCTCGAAG
TTTTCCATGCTTTCCTTTCGGTTGCATCTTTCTTCCTTTGGGGTTTTATCTTGATACGTC
GTTACTTACCTTTTTTTCCAATATATATATATTGGTAGTAGCTGATCATTGCAGAAGATC
TAGATCTCCTTTACACGCTTTAAGGTTAGGCAGCTGTAACCCCTATATTGAATTTTCACC
CACGCCATAAAATACAATAGCTCAGAGAACCGGTGGCCAC
Chr coordinates Chr VII from 988049-989419
w3c xhtml validator w3c css validator